Nonspecific Cation Current Associated with Native Polycystin-2 in HEK-293 Cells
Bruna Pelucchi*,
Gianluca Aguiari,
Angela Pignatelli*,
Elisa Manzati,
Ralph Witzgall,
Laura del Senno and
Ottorino Belluzzi*
Departments of * Biology and Biochemistry and Molecular Biology, University of Ferrara, Ferrara, Italy; and Institute for Molecular and Cellular Anatomy, University of Regensburg, Regensburg, Germany
Address correspondence to: Dr. Bruna Pelucchi, University of Ferrara, Department of Biology, Via L. Borsari 46, Ferrara I-44100, Italy. Phone: +39-0532-291485; Fax: +39-0532-207143; E-mail: plb{at}dns.unife.it
Received for publication December 29, 2004.
Accepted for publication November 21, 2005.
Mutations in either PKD1 or PKD2 gene are associated with autosomaldominant polycystic kidney disease, the most common inheritedkidney disorder. Polycystin-2 (PC2), the PKD2 gene product,and the related protein polycystin-L, function as Ca2+-permeable,nonselective cation channels in different expression systems.This work describes a nonspecific cation current (ICC) thatis present in native HEK-293 cells and highly associated witha PC2-channel activity. The current is voltage dependent, activatingfor potentials that are positive to 50 mV and inactivatingin a few milliseconds. It is sensitive to Cd2+, Gd3+, La3+,SKF96365, and amiloride. After silencing of PC2 by RNA interfering,cells show a reduced current that is restored by transfectionwith normal but not truncated PC2. Consistently, ICC is abolishedby perfusion with an anti-PC2 antibody. Furthermore, heterologousexpression of the PC1 cytoplasmic tail significantly increasesICC peak amplitude compared with native cells. This is the firstcharacterization of such a current in HEK-293 cells, a widelyused expression system for ion channels. These cells, therefore,could be regarded as a suitable and readily accessible toolto study interactions between native PC2/PC1 complex and othermembrane proteins, thus contributing to the understanding ofautosomal dominant polycystic kidney disease pathogenesis.
Autosomal dominant polycystic kidney disease (ADPKD) accountsfor approximately 10% of all cases of ESRD (1). Two genes areinvolved in ADPKD pathogenesis: PKD1 and PKD2 (2,3), and mutationsin either cause virtually the same clinical picture.
Since the characterization of the two gene products, PC1 andPC2, further homologous proteins have been identified, but theirrole in ADPKD pathogenesis is not yet clear. According to sequencesimilarities, they are classified in PC1-like (PC1, PC1L2, PC1L3,and PCREJ) and PC2-like (PC2, PCL, and PC2L2) proteins.
PC1 is an integral plasma membrane glycoprotein that has a largeextracellular N-terminal domain, up to 11 transmembrane domains,and a relatively short intracellular carboxyl tail (4) and hasbeen shown to interact functionally with the C-terminus of PC2and other proteins (5). PC2 and PCL are voltage-dependent, Ca2+-modulated,nonselective cation channels (611), with a moderate homologywith TRP channels and voltage-activated Ca2+ and Na+ channels(12).
In this study, we demonstrate that HEK-293 cells express a novelvoltage-dependent inactivating inward current, highly associatedwith, if not sustained by, PC2-channel activities. To our knowledge,this is the first electrophysiologic evidence for such a currentin native HEK-293 cells. Therefore, native HEK-293 cells couldbe regarded as an alternative and readily accessible model tostudy interactions between PC1 and PC2 and other putative partners,in experimental conditions that are unaltered by heterologousexpression, thereby contributing to a better understanding ofADPKD pathogenesis. Furthermore, these data suggest that greatprecaution should be taken when this widely used expressionsystem is used to study similar ion channels.
DNA Constructs and Cell Lines
For silencing PKD2 gene expression, two oligonucleotides (F,5'GATCCCCTTCAAGAGATTTTGGAAA3' and R,5'AGCTTTTCCAAAAATCTCTTGAAGGG3') that contain the underlinedPKD2 cDNA sequence, localized at nt + 1659 (NM-000297), werecloned in pSuper vector expression system (Oligoengine, Seattle,WA). The recombinant vector was co-transfected (ratio 1:10)with the G418 antibiotic-resistance pCDNA3 vector (InvitrogenC, Carlsbad, CA) in HEK-293 cells. After 3 wk of selection,stable HEKPKD2 clones (WTPC2) and HEKpSuper controlclones were isolated. WTPC2 cells were transiently transfectedwith plasmids that express a green fluorescence proteintaggedfull-length PC2 (FLPC2) and, as control, hemagglutinin-taggedPC2 truncated at codon 604 in loop 4 (PC2stop), with the Ca2+phosphate precipitation (13,14). PC2 expression was detectedby Western blot analysis by using the antiN-terM anti-PC2antibody, purified by immunoaffinity against its peptide asdescribed previously (13). In immunofluorescence experiments,cells were cultured on 24-mm coverslips for 24 h. After twowashes with PBS buffer, cells were fixed in 4% formaldehydePBS solution for 30 min at room temperature, treated with PBSthat contained 50 mM NH4Cl for 10 min, and then washed twicein PBS. Cells were permeabilized in PBS 0.1% Triton X 100 for5 min and washed twice with PBS. Coverslips were treated with1 ml of antiPC2 Nter M antibody (50 µg) solutionthat contained 0.2% gelatin at room temperature for 2 h. Afterthree washes with PBS, cells were treated with a PBS 0.2% gelatinsolution that contained a secondary anti-rabbit rhodamine-conjugatedantibody (Santa Cruz [DBA], Milano, Italy) at room temperaturein dark condition for 1 h. After three washes in PBS, cellswere analyzed by a Zeiss Axiovert 200 fluorescence microscopeequipped with a back-illuminated CCD camera (Roper Scientific,Tucson, AZ), excitation and emission filter wheels (Sutter InstrumentCompany, Novato, CA), and piezoelectric motoring of the z stage(Physik Instrumente, GmbH and Co., Karlsruhe, Germany). In someexperiments, the antiN-term anti-PC2 antibody was addedto the pipette solution and, after whole cell configurationwas reached, a series of ramps protocols were applied at a rateof 0.1/s, the first one to be used as internal control.
Electrophysiology
Cell plates were transferred into a recording chamber and securedto an upright Olympus microscope. Cells were perfused with standardsaline that contained (in mM) 152 NaCl, 2.5 KCl, 2 CaCl2, 1MgCl2, and 5 HEPES free acid. The pH was adjusted to 7.4 withNaOH for all bath solutions. Osmolality was adjusted to 305mOsm/kg with sucrose. Standard pipette solution contained (inmM) 120 KCl, 10 NaCl, 2 MgCl2, 0.5 CaCl2, 5 EGTA, 10 HEPES,and 2 ATPMg. The pH and the osmolality were adjusted to 7.2with KOH and to 310 mOsm/kg with sucrose, respectively. Whenfilled with intracellular solution, the pipette resistance inthe bath was in the range of 5 to 6 M.
All chemicals were purchased from Sigma Aldrich (St. Louis,MO) except tetrodotoxin (TTX), charibdotoxin (ChTx), and paxilline(Alomone Labs, Jerusalem, Israel).
Electrical recordings were performed by an Axopatch 200B patch-clampamplifier (Axon Instruments, Inc., Union City, CA). Seal resistancewas always >3 G. Series resistance was routinely compensatedat 80%. Membrane currents were sampled at 10 kHz after filteringat the corresponding Nyquist frequency by a four-pole Besselfilter and were acquired on a PC-486 computer with 12-bit A/D-D/ADigidata 1200B converter (Axon Instruments). Voltage protocolgeneration and data acquisition were performed using pClampversions 7.0.1 (Axon Instruments). Correction for liquid-junctionpotentials was applied directly to the holding potential (15).To avoid electrical coupling among cells as a result of gapjunctions, only isolated cells were recorded.
Results are given as mean ± SEM and examined by nonparametricstatistical tests. P < 0.05 was considered statisticallysignificant.
General Observations
In native HEK-293 cells, depolarizing commands from a holdingpotential of 120 mV in voltage-clamp whole-cell configurationevoked a large outward current (7.25 pA/pF ± 1.03; n= 40) and a much smaller inward current (2.35 ±0.02 pA/pF; n = 106; Figure 1a). The overall excitability profilestrongly depended on the holding potential: The small inwardcurrent developed to full size only when a preconditioning pulseat a negative potentials was applied (120 mV in Figure 1a,left) but disappeared when the holding potential was 0 mV(Figure 1a, right). The last experimental condition also reducedthe outward current amplitude (mean decrement 62.6 ±11.8%; n = 7; Figure 1a).
Figure 1. Current pattern in native HEK-293 cells. (a) Voltage-clamp recordings from a typical native HEK-293 cell stimulated with protocols shown in the inset. Depolarization to potentials from 50 to 70 mV in 20-mV steps were preceded by a 200 ms of preconditioning pulse at 120 mV (left traces, protocol; solid line) or 0 mV (right traces, protocol; dotted line). More positive holding potentials cause, besides a voltage-dependent inactivation of the inward current, a reduction in the outward one. Current traces are plotted in terms of current density (pA/pF) to normalize the total current to cell area. The mean cell membrane capacitance was 25.8 ± 2.32 pF (n = 40). Between trials, holding potential was kept at the resting potential of the cell (27.1 ± 2.8 mV). Leak currents were subtracted online. (b) Inward current peak amplitude distribution. , Failures in nonspecific cation current (ICC) observation. (c) Instantaneous IV relationship obtained by means of a ramp protocol, as shown in the inset. Leak currents were subtracted offline. Comparison of different ramp steepness: 9.5 V/s or 0.19 V/s.
The inward current was observed in 81.1% of cells (n = 106).Inward current peak amplitude was variable, and its distributionwas skewed to the right (Figure 1b). No significant differenceswere observed in different cell batches. When ramp protocolswere used instead of square pulses, the inward current was observedonly when the ramp slope was sufficiently steep (Figure 1c).
Ionic and Pharmacologic Properties of the Inward Current
We first tried to identify the ionic basis of the inward current.To determine the reversal potential (Erev), the inward currentwas evoked by a depolarizing step at 0 mV from a holding potentialof 120 mV. At the current peak, the membrane was instantlyrepolarized to potentials ranging from 20 to 80 mV (Figure 2a,inset). The tail current amplitude allowed determinationof the instantaneous IV relationship, with a reversalpotential of 47.6 mV (Figure 2a). This value was not coincidentwith the equilibrium potential of any of the ions present instandard saline and was 12.6 mV more negative than ENa (60.2mV).
Figure 2. Ionic and pharmacologic properties of ICC. (a) ICC reversal potential (Erev) calculated as the zero current point, from linear regression to the instantaneous IV relationship, obtained by means of the protocol shown in the inset. Data were obtained in 30 mM TEA. Arrow indicates Na+ equilibrium potential, as calculated from Nerst. (b) Instantaneous IV relationship obtained by the ramp protocol shown in the inset. Traces were recorded in control solution, in N-methyl-d-glucamine (NMDG)-saline, and back in control (wash). In NMDG-saline, all external Na+ was replaced with equimolar amounts of NMDG. (c) Effect of equimolar substitution of external Na+ with different monovalents (light gray columns) or substitution of external Ca2+ (dark gray column) with 4 mM Ba2+. The effects were calculated as the ratio between inward current peak amplitude before and after the treatments. Vertical dashed line indicates control level. Substitutions with Li+, NH4+, Rb+, and Cs+ were performed on the same set of cells (P < 0.001, n = 6). Data on K+ permeability were obtained in a high external [K+] solution, which contained 152 mM KCl and 0 mM NaCl, by means of the protocol shown in d. For reversing K+ gradient, all NaCl and KCl in the pipette solution were substituted with NMDG. (d) Traces evoked by a single depolarizing step from 120 to 10 mV (inset) in control and high external K+ solution. Pipette was filled with (in mM) 120 NMDG, 20 TEA-Cl, 0 NaCl, 0 KCl, 0.5 CaCl2, and 2 MgCl2. In the presence of a reversed K+ gradient and in the absence of Na+, an inward current was still present, although reduced in amplitude. (e) Pharmacologic sensitivity of ICC to several drug applications (see text) (n = 6). The effects were calculated as the ratio between peak amplitude before and after treatments. Vertical dashed line indicates control level. (f) IV relationship obtained by a fast (9.5 V/s) ramp protocol in control solution, in 0 Ca2+/10 mM EGTA saline, and back in control. EGTA saline was obtained by replacing an equimolar amount of NaCl with 10 mM EGTA and adding no Ca2+. Residual K+ current (IK) in EGTA saline was lower than control but similar in extent to the one recorded, in the same cell, when ICC was completely inactivated by a slower ramp protocol (0.19 V/s). (g) IV relationship obtained by a fast ramp protocol (9.5 V/s) in control solution, after substitution of extracellular Ca2+ with 4 mM Ba2+, and back in control.
The channel permeability to cations was tested by substitutingexternal Na+ with equimolar amount of different monovalents:Substitution of external Na+ with N-methyl-d-glucamine (NMDG;Figure 2b), an impermeant cation, reversed inward current. Conversely,no differences in the outward current were observed. The reversedcurrent was not due to an efflux of internal Na+, as it wasalso observed when this ion was substituted with NMDG in theinternal solution (data not shown). The rank order of monovalentpermeability, as deduced from peak current amplitudes, was Na+> Li+ > NH4+ > K+ > Rb+ (Figure 2c). Substitutionof Na+ with Cs+ induced a suppression of the inward current.When all of the external NaCl was substituted with KCl and monovalentsin pipette solution were replaced by an equimolar amount ofNMDG (Figure 2d), it was still possible to observe the inwardcurrent, albeit lower than in control (31.75 ± 0.04%;n = 6).
The inward current was insensitive to blockers of chloride channels(200 µM anthracene-9-carboxylic acid [9-AC] and 100 µMniflumic acid), of voltage-gated Na channels (1 µM TTX)and K+ channels (30 mM TEA) and of L-type Ca2+ channel (100µM nifedipine). The current was also unaffected by applicationof P-receptor antagonist (100 µM suramine), of membrane-permeantcyclic nucleotide analogs (100 µM 8-Br-cGMP and 8-Br-cAMP),of Ca2+ entry channel inhibitor 25 µM 2-aminoethoxydiphenylborane(APB), and of ENaC channel blocker 1 µM amiloride (Figure 2e).In standard experimental condition, ECl was near 0 mV.Consistent with insensitivity to 9-AC and niflumate, changesin external [Cl] (data not shown) did not modify inwardcurrent amplitude. Conversely, this current was significantlyreduced (Figure 2e) by application of nonselective cation channelsblockers (16,17) such as 100 µM Cd2+, 100 µM Ni2+,1 mM Gd3+, 1 mM La3+, 100 µM SKF96365, and higher concentrationsof amiloride (100, 200, and 500 µM).
In cells that were perfused with 0 Ca2+-EGTA saline (Figure 2f),the current peak amplitude decreased by 12.4 ± 4.55%(n = 6; P < 0.05). It is noteworthy that, besides this effecton the peak inward current amplitude, a reduction in the outwardcurrent was also observed (54.1 ± 12.9%; n = 6; P <0.05). Substitution of external Ca2+ with 4 mM Ba2+ (Figure 2g)ensued to a slight increase in the inward current (13.8± 2.07%; n = 5; P < 0.05) and to a large decreasein the outward current (73.3 ± 10.6%; n = 5; P < 0.05).Because of its ionic and pharmacologic properties, the inwardcurrent hereafter is indicated as nonspecific cationic current(ICC).
Kinetic Properties of ICC
Although the maximal current amplitude was variable from cellto cell, its ionic composition, as well as kinetic and pharmacologicproperties, was identical in all cells examined. To improvethe accuracy of the study, we performed kinetic analysis ina group of 10 cells that showed currents larger than 100pA. Interference by the larger outward current was preventedby application of TEA 30 mM.
The IV relationship was obtained by applying 20 ms ofdepolarizing pulses ranging from 80 mV to 60 mV, in 20-mVincrements, from a holding potential of 120 mV, to completelyremove voltage-dependent inactivation (Figure 3a, inset). Theinward current could be evoked at potentials that were morepositive than 50 mV and peaked at 10 mV (Figure 3a).Cells were conditioned for 300 ms to different holdingpotentials and then depolarized to 0 mV (Figure 3b, inset).This allowed us to determine the steady-state inactivation curve(Figure 3c, ). To determine the steady-state activation curve(Figure 3c, ) the peak current was divided by the driving forceand then normalized with respect to maximum value. The inwardcurrent inactivated rapidly, with an average time constant of1.1 ± 0.12 ms at 0 mV (n = 10), whereas the removal ofinactivation, studied with a conventional double-pulse protocol,was a much slower process ( = 43.5 ± 0.95 ms; n = 6;Figure 3d).
Figure 3. Voltage dependence of ICC. (a) Average IV relationship obtained in TEA saline in 10 sample cells, by the protocol shown in the inset. (b) Development of inactivation. Family of tracings obtained in one representative cell in response to the protocol shown in the inset. (c) Steady-state activation curve, a, (). The experimental points (average of 10 cells) were fitted by the Boltzmann equation a = 1/{1 + exp[(V0 V)/k]}, where the half activation voltage, V0, was equal to 20.5 mV and the slope factor, k, is equal to 9.45 mV. The steady-state inactivation curve, i(V) (, average of six cells) was fitted by the Boltzmann equation: i = 1/{1 + exp[(V V0)/k]}, where V0 = 62.6 mV and k = 9.48 mV. (d) Time course of removal of inactivation at 80 mV. Family of tracings obtained by a double pulse protocol (inset), consisting of two subsequent steps to 0 mV, the first from a holding potential of 120 mV and the second after a variable time at 80 mV. The peak amplitude of the current evoked by the second pulse increased exponentially with time (t = 43.5 ± 0.95 ms; n = 6; solid line) as a result of an increasing percentage of channels recovered from inactivation.
Outward Current
The outward current was completely blocked by perfusion withTEA 30 mM saline (Figure 4a) and was insensitive to Clchannel blockers (Figure 4b). It therefore was identified asa K+ current (IK).
Figure 4. Presence of a calcium-activated component in IK. (a) Mean IV relationship obtained in six sample cells by a fast ramp protocol (9.5 V/s). Traces were obtained in control solution, in TEA-saline, and back in control (washout). In TEA-saline, equimolar amounts of NaCl were replaced by 30 mM TEA. (b) Pharmacologic sensitivity of IK. The effects were calculated as the ratio between peak amplitude before and after treatments. Horizontal dotted line indicates control level. (c) IV relationship obtained in control solution in the presence of paxilline, and back in control, obtained by means of a fast ramp protocol (9.5 V/s). Once again, the paxilline-insensitive component of IK was similar in extent to that recorded, in the same cell, after ICC had completely been inactivated by a slower ramp protocol (0.19 V/s). (d) Application of amiloride in a cell that was stimulated by the same protocol of a. A proportional reduction in both inward and outward currents was evident at increasing the concentration of the drug.
In the presence of 100 nM ChTx and paxilline (Figure 4b), twoselective blockers of BK-type Ca2+-activated voltage-dependentK+ channels (18,19), the total IK was decreased to 55.0 ±17.3% (ChTx, n = 3) and to 48.5 ± 15.4% (paxilline, n= 3). Conversely, 100 µM apamine, a selective blockerof SK-type Ca2+-dependent K+ channels (20), and 100 µMnifedipine, an L-type CaV-channel blocker, were ineffective(Figure 4b). The paxilline-insensitive component of IK was similarin extent to that observed after inactivation of ICC by meansof a slower ramp protocol (Figure 4c).
All drugs that blocked ICC ensued also in a partial decreaseof IK. In particular (Figure 4d), the progressive block of ICCthat was induced by increasing concentrations of amiloride ledto a proportional reduction in IK.
Molecular Biology Experiments
Because many, although not all, of the properties of this channelactivity were similar to those of PC2, whose presence at endoplasmicreticulum and plasma membrane in native HEK-293 cells has alreadybeen reported (14) and shown in Figure 5a, we tested whetherthe ICC could be mediated by these channels. For assessmentof this hypothesis, PC2 expression was inhibited by siRNA-mediatedsuppression. Figure 5a shows representative current traces forma control (upper), a WTPC2 (center), and a WTPC2/FLPC2cell (lower), respectively. In WTPC2 cells, the currentdecreased in amplitude and was completely absent in a highernumber of cells (37.5 versus 18.9%). The ICC mean peak amplitudewas significantly lower than in native control cells (1.08± 0.36 pA/pF versus 2.54 ± 0.23 pA/pF;n = 20; P < 0.05; Figure 5b), suggesting that ICC is associatedwith, if not indeed sustained by, PC2 expression. To assesswhether the decrease of ICC in silenced cells was specificallydue to PC2 expression inhibition, we tested whether transienttransfection with GFP-tagged heterologous PC2 could restorethe current. Cells in which the transient transfection was ableto escape silencing were identified by the green fluorescence.These cells did show a positive staining at plasma membranelevel (Figure 5b), indicating that, despite the presence ofPKD2 siRNA, the exogenously overexpressed PKD2 RNA did likelyovercome the "nontotal" efficiency of the siRNA. This was consistentwith the slight immunoblot detection of endogenous PC2 in WTPC2siRNAsuppressed cells (Figure 5a, inset). When WTPC2cells were transiently transfected with heterologous PC2 (WTPC2/FLPC2),ICC peak amplitude recovered to a higher value than control(4.48 ± 0.32 pA/pF; P < 0.05; n = 16), whereastransient transfection with a PC2 that lacked the PC1 interactingregion (WTPC2/PC2stop) was ineffective (1.19 ±0.58; n = 16). In WTPC2 cells, IK was also reduced (4.32± 0.90 versus 7.28 ± 1.26 pA/pF; n = 16; P <0.5), and this effect was rescued in WTPC2/FLPC2 cells(14.5 ± 1.14 pA/pF; n = 16; P < 0.5) but not in WTPC2/PC2stopcells (4.17 ± 0.78 pA/pF; n = 16; Figure 5b).
Figure 5. Effect of modification of PC2 and PC1 expression on current amplitude. (a) Voltage-clamp recordings, obtained by means of the indicated protocol, from a control HEKpSuper cell (upper trace, Cm = 21 pF), a WTPC2 (center trace, Cm = 19 pF), and a WTPC2 cell transiently transfected with full-length heterologous GFP-tagged PC2 (lower trace, WTPC2/FLPC2, Cm = 24 pF). (Inset, left) Immunofluorescence analysis of PC2 in native HEK-293 cells. (Inset, right) Western blot analysis of PC2 in HEKpSuper cells (lane 1), in HEKpSuperCS cells stably transfected with the siRNA expressing a PKD2-unrelated sequence (lane 2), and in WTPC2 cells (lane 3). Approximately 20 µg of total cell extracts were analyzed by Western blotting and probed with antiN-terM PC2 (PC2) and with anti-actin (actin). (b) Mean peak amplitude of ICC (
) and of total IK () measured in control cells (n = 20), WTPC2 cells (n = 20), WTPC2/FLPC2 (n = 16), and WTPC2 cells overexpressing the truncated PC2 (WTPC2/PC2stop; n = 16). (Inset) Fluorescence analysis of WTPC2/FLPC2-GFP cells showed staining of both endoplasmic reticulum and plasma membrane. (c) Intracellular perfusion with an antiN-terM PC2 and an anti-Ig antibody. Antibodies (150 µg/ml) were added to the pipette solution, and after whole-cell configuration was reached, a series of ramps protocols were applied, at a rate of 0.1/s, the first one to be used as internal control. (Top) Currents evoked by a single depolarizing step to 0 mV, from a preconditioning level of 120 mV (inset). Three traces, recorded immediately, after 1.5 min, and after 2 min after cell membrane rupture, are superimposed. (Bottom) Mean peak amplitude of ICC () and of total IK () measured immediately after whole-cell configuration was obtained (time zero, left, n = 32), after at least 3 min of perfusion with the antiN-terM PC2 (center; n = 16) or an anti-Ig antibody (right; n = 16). (d) Voltage-clamp recordings, obtained by the protocol shown in a, from a TrkPC1 cell overexpressing the PC1 tail (14,21), with Cm = 23 pF. (e) Mean peak amplitude of ICC measured in a set of native cells (n = 106), in Trk0 cells (14,21) lacking the PC1 sequence (n = 32), and in TrkPC1 cells (n = 106). (f) Schematic drawing of a possible functional co-localization of ICC and IK(Ca) (see Discussion for further details).
Consistently, as shown in Figure 5c, intracellular perfusionwith an anti-PC2 antibody (antiN-terM) (13,14), targetingthe PC2 N-terminal region, almost completely abolished the inwardcurrent (0.22 ± 0.12 pA/pF) with respect to control (2.89± 0.21 pA/pF; n = 16). The full effect developed in approximately2 min (n = 16; mean time 2 hr 20 min ± 20 min) afterthe whole-cell configuration was obtained. As control, currentsthat were recorded in cells that were perfused with anti-Igantibody remained unaffected up to 45 min.
Because PC2 channels are known to be modulated by PC1, we analyzedthe ICC current evoked in cells that were transfected with PC1cytoplasmic tail anchored to the plasma membrane via the transmembranedomain of Trk-A (HEKTrkPC1) (13,21). As shown in Figure 5d,recordings that were obtained in HEKTrkPC1 cells ICCwere qualitatively similar to but higher than those that wereobtained in native HEK-293 (4.6 ± 0.05 versus2.35 ± 0.02 pA/pF; n = 106; P < 0.05), whereasin HEKTrk0 cells, expressing membrane Trk-A regions only, currentamplitude was similar to that of native cells (2.27 ±0.65 versus 2.41 ± 0.13 pA/pF; n = 16; P >0.5; Figure 5e). In particular, the steady-state activationand inactivation curves and the normalized IV relationshipwere virtually identical (data not shown). The number of cellsin which ICC was absent was much greater in control HEKTrk0cells (19.9 versus 5.7%), whereas the percentage of cells thatdisplayed medium (5 to 10 pA/pF) or large (>10 pA/pF) peakcurrents were much higher in HEKTrkPC1 cells (32.0 versus 10.4;n = 106). Also, total IK was larger in HEKTRKPC1 cells, butthis increase was NS (7.54 ± 1.06 in control versus 9.05± 1 0.29 pA/pF in transfected cells; n = 40; P > 0.5;data not shown). Immunofluorescence analysis on native and full-lengthPC2 transfected cells (Figure 5, g and h, respectively) by primaryantiN-terM and secondary rhodamine-conjugated antibodyfurther confirm the presence of PC2 at plasma membrane level.
Here we present the first functional evidence for a native ICCnot previously described in HEK-293 cells and highly associatedwith PC2, that is expressed on cell plasma membrane (14). Thesubcellular localization of PC2 has been a subject of debate.Although different works suggest that PC2 is an endoplasmicreticulum resident protein (8,22), other evidence (23,24) supportsits functional presence on the plasma membrane. It has indeedbeen demonstrated (25) that PC1 and PC2 co-distribute in primarycilia of kidney epithelium, most likely playing a critical rolein the mechano-transduction pathway that allows fluid flow sensitivity.
HEK-293 cells are a widely used expression system for ion channelstudies, although they are provided by a complex set of endogenouscurrents. Despite many observations of a TEA-sensitive delayedrectifier K+ current, not all authors agree about the presenceof native chloride conductances (26,27). A voltage-dependentCa2+ current, sensitive to dihydropyridine but different fromL-type, has been described (28). Occasionally, findings of avoltage-dependent TTX-sensitive Na+ current have also been reported(29), although HEK-293 cells endogenously express the auxiliary1A-subunit of voltage-gated sodium channel but not the pore-forming one (30). In addition, a nonspecific cation channel (31) hasbeen described. Recordings of an ultraviolet lightinducednonselective cation current (32) and functional expression ofa proton-gated channel (33) and of several members of the TRPCchannel family (34,35) also contribute to this complex picture.The lack of previous observations of ICC and IKCa in HEK-293cells is not surprising given the large negative holding potentialthat is necessary to avoid ICC inactivation and to the tightfunctional link between the two.
As concerns ICC identification, the decrease in its peak amplitudeafter either PC2 selective silencing or perfusion with the anti-PC2antibody indicates that it is highly associated with, if notsustained by, PC2. Nevertheless, some features of the nativecurrent here described do not perfectly match those of PC2.In particular, depending on the cell system, PC2 has been reportedto be more or equally permeant to K+ in respect to Na+ (36),whereas here we report a higher Na+ selectivity with respectto K+ (3:1). This discrepancy does not necessarily rule outthat ICC can be mediated by PC2. It has been reported that differentexpression systems, in the case of channel reconstitution, ortissue specificity, in the case of native channel activity (25,37),can modify biophysical channel properties, as a result of co-assemblywith different subunits or to specific posttranscriptional processing.In particular, hetero-oligomerization among PC2 and TRPC channelshas been described (38). This observation may be important consideringthat, as previously mentioned, several members of the TRPC family,as well as voltage-gated channels, are expressed in native HEK-293cells. If such a hetero-oligomerization takes place in nativeHEK-293, regarding TRPC or other endogenous channel subunits,then this could account for functional changes of the purportednative PC2 channel.
Although we were unable to detect any Ca2+ influx, we founda decrease in ICC in the absence of external Ca2+ and an increaseafter substitution of external Ca2+ with Ba2+. Moreover, weprovided independent and consistent evidences that a Ca2+ influxthrough ICC is required to trigger an IK(Ca), thus allowingus to use the latter as a biosensor for Ca2+ influx: When ICCwas inactivated by preconditioning the membrane at 50mV or by means of a slow voltage ramp (0.19 V/s), the amplitudein IK was also decreased. Consistently, all drugs that blockedICC ensued also in a partial decrease of IK that was insteadunaffected when cells were perfused with NMDG-saline or forextracellular Na+ substitution with different monovalents, despitethe great ICC amplitude reduction caused by these treatments.In the absence of extracellular Ca2+, IK was reduced and theresidual component was comparable with that observed after inactivationof ICC by preconditioning at 50 mV. In 4 mM Ba2+, whichis known not to activate IK(Ca) (18), IK was reduced, despitethe light increase in ICC peak amplitude. Furthermore, IK amplitudewas lowered by PC2 silencing and by anti-PC2 perfusion.
Taken together, all data strongly suggest a functional couplingbetween ICC and a fraction of IK, by means of an ionic fluxdifferent from monovalents, most likely an external Ca2+ influx.This suggests that the IK here described is, in fact, the sumof a classical delayed rectifier current and of a Ca2+-dependentK+ current, IK(Ca). The sensitivity of this current to ChTxand paxilline but not to Apamine further confirms its identificationas a BK-type IK(Ca).
It is interesting that ICC is enhanced, without changes in itsproperties, by overexpression of the PC1 tail that containedthe PC2 interacting domain. This is in agreement with formerfindings that expression of TrkPC1 peptide increases the ATP-and serum-evoked cytosolic Ca2+ concentration (13,14). The ATP-evokedincrease has a biphasic pattern with a peak as a result of therelease from intracellular stores and a plateau as a resultof the Ca2+ influx through cationic Ca2+-permeable plasma channels.The last component may be sustained by the current describedhere.
Increasing evidence suggests that a functional co-localizationof Ca2+-activated K channels and Ca2+ channels could occur,thus leading to specific effects by local increase in intracellularCa2+ (3941). If this were the case in HEK-293 cells,as schematically drawn in Figure 5f, then this may explain howeven a small calcium influx through ICC could be effective inactivating IK(Ca). Because PC1 seems to be required for recruitmentof PC2 to the plasma membrane (23), the heterologously expressedPC1 could translocate to it additional PC2 molecules, thus increasingthe current.
As concerns pharmacologic profile of ICC, although qualitativelyconsistent with PC2 sensitivity (9,10,36,42), it must be notedthat amiloride, La3+, Gd3+, and Ni2+ lack specificity, blockingvarious channels and transporters. The dose-response relationof the effect of amiloride on ICC (data not shown) gave a half-maximuminhibition at 245 µM, slightly higher than that reportedfor native PC2 (36). Significantly, values much similar to ourswere observed in native PC2 from rat left ventricular myocytes(130 µM) (42), and it must be considered that even inthe same experimental model, drug sensitivity could significantlydiffer when estimated by whole-cell or single-channel recording(43). We also reported sensitivity to Cd2+ and to SKF96365,a Ca2+ entry blocker that inhibits also nonselective channelsin endothelial cells (16).
Although many studies report no voltage dependence of PC2 (10,23,36),our data are consistent with the reported increase of Po withnegative potentials (79,11). Changes in PC2 expressionby either endogenous or heterologous PC2, as well as heterologousPC1 expression and cell perfusion with anti-PC2 antibody, doaffect ICC, suggesting that it could be sustained by PC2. Nevertheless,the ionic permeability and the pharmacologic sensitivity ofICC do not perfectly match those of PC2, as reported in theliterature. As a consequence, a much more indirect associationbetween ICC and PC2 cannot be excluded. A biophysical characterizationby means of single-channel patch-clamp technique will be ofgreat interest to assess these two different predictions.
If our hypothesis is confirmed, then HEK-293 cells could beregarded as a suitable and readily accessible tool to studyPC1 and PC2 macromolecular interactions, thus contributing tothe elucidation of physiopathologic mechanisms of ADPKD.
Acknowledgments
We gratefully acknowledge Dr. Mascia Benedusi and Dr. LuciaCadetti for participating in some initial recordings, Dr. ErikaFranzoni for technical assistance, and Dr. Elisabeth Jankinsfor reading of the manuscript in English. This work was supportedby grants from MURST, CaRiFe, and Telethon (E1250).
Preliminary data were presented at the EMBO meeting, Capri,September 20 to 23, 2004; and at the XVIII SIBPA meeting, Pisa,Italy, September 23 to 25, 2004.
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
Gabow PA, Granthamj J: Polycystic kidney disease. In:
Diseases of the Kidney, 6th Ed., edited by Schrier RW, Gottschelk CW, Boston, Little, Brown & Co, 1997
, pp 521
560
The polycystic kidney disease 1 gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. The European Polycystic Kidney Disease Consortium.
Cell 77
: 881
894, 1994[CrossRef][Medline]
Polycystic kidney disease: The complete structure of the PKD1 gene and its protein. The International Polycystic Kidney Disease Consortium.
Cell 81
: 289
298, 1995[CrossRef][Medline]
Hughes J, Ward CJ, Peral B, Aspinwall R, Clark K, San Millan JL, Gamble V, Harris PC: The polycystic kidney disease 1 (PKD1) gene encodes a novel protein with multiple cell recognition domains.
Nat Genet 10
: 151
160, 1995[Medline]
Lakkis M, Zhou J: Molecular complexes formed with polycystins.
Nephron Exp Nephrol 93
: e3
e8, 2003[CrossRef][Medline]
Vassilev PM, Guo L, Chen XZ, Segal Y, Peng JB, Basora N, Babakhanlou H, Cruger G, Kanazirska M, Ye C, Brown EM, Hediger MA, Zhou J: Polycystin-2 is a novel cation channel implicated in defective intracellular Ca(2+) homeostasis in polycystic kidney disease.
Biochem Biophys Res Commun 282
: 341
350, 2001[CrossRef][Medline]
Gonzalez-Perrett S, Batelli M, Kim K, Essafi M, Timpanaro G, Moltabetti N, Reisin IL, Arnaout MA, Cantiello HF: Voltage dependence and pH regulation of human polycystin-2-mediated cation channel activity.
J Biol Chem 277
: 24959
24966, 2002[Abstract/Free Full Text]
Koulen P, Cai Y, Geng L, Maeda Y, Nishimura S, Witzgall R, Ehrlich BE, Somlo S: Polycystin-2 is an intracellular calcium release channel.
Nat Cell Biol 4
: 191
197, 2002[CrossRef][Medline]
Xu GM, Gonzalez-Perrett S, Essafi M, Timpanaro GA, Montalbetti N, Arnaout MA, Cantiello HF: Polycystin-1 activates and stabilizes the polycystin-2 channel.
J Biol Chem 278
: 1457
1462, 2003[Abstract/Free Full Text]
Chen XZ, Vassilev PM, Basora N, Peng JB, Nomura H, Segal Y, Brown EM, Reeders ST, Hediger MA, Zhou J: Polycystin-L is a calcium-regulated cation channel permeable to calcium ions.
Nature 401
: 383
386, 1999[CrossRef][Medline]
Liu Y, Li Q, Tan M, Zhang YY, Karpinski E, Zhou J, Chen XZ: Modulation of the human polycystin-L channel by voltage and divalent cations.
FEBS Lett 525
: 71
76, 2002[CrossRef][Medline]
Mochizuki T, Wu G, Hayashi T, Xenophontos SL, Veldhuisen B, Saris JJ, Reynolds DM, Cai Y, Gabow PA, Pierides A, Kimberling WJ, Breuning MH, Deltas CC, Peters DJ, Somlo S: PKD2, a gene for polycystic kidney disease that encodes an integral membrane protein.
Science 272
: 1339
1342, 1996[Abstract]
Aguiari G, Banzi M, Gessi S, Cai Y, Zeggio E, Manzati E, Piva R, Lambertini E, Ferrari L, Peters DJ, Lanza F, Harris PC, Borea PA, Somlo S, Del Senno L: Deficiency of polycystin-2 reduces Ca2+ channel activity and cell proliferation in ADPKD lymphoblastoid cells.
FASEB J 18
: 884
886, 2004[Abstract/Free Full Text]
Aguiari G, Campanella M, Manzati E, Pinton P, Banzi M, Moretti S, Piva R, Rizzuto R, Del Senno L: Expression of polycystin-1 C-terminal fragment enhances the ATP-induced Ca2+ release in human kidney cells.
Biochem Biophys Res Commun 301
: 657
664, 2003[CrossRef][Medline]
Neher E: Correction for liquid junction potentials in patch clamp experiments.
Methods Enzymol 207
: 123
131, 1992[Medline]
Nilius B, Viana F, Droogmans G: Ion channels in vascular endothelium.
Annu Rev Physiol 59
: 145
170, 1997[CrossRef][Medline]
Inoue R, Okada T, Onoue H, Hara Y, Shimizu S, Naitoh S, Ito Y, Mori Y: The transient receptor potential protein homologue TRP6 is the essential component of vascular alpha(1)-adrenoceptor-activated Ca(2+)-permeable cation channel.
Circ Res 88
: 325
332, 2001[Abstract/Free Full Text]
Sun XP, Schlichter LC, Stanley EF: Single-channel properties of BK-type calcium-activated potassium channels at a cholinergic presynaptic nerve terminal.
J Physiol 518
: 639
651, 1999[Abstract/Free Full Text]
Miller C, Moczydlowski E, Latorre R, Phillips M: Charybdotoxin, a protein inhibitor of single Ca2+-activated K+ channels from mammalian skeletal muscle.
Nature 313
: 316
318, 1985[CrossRef][Medline]
Hu H, Shao LR, Chavoshy S, Gu N, Trieb M, Behrens R, Laake P, Pongs O, Knaus HG, Ottersen OP, Storm JF: Presynaptic Ca2+-activated K+ channels in glutamatergic hippocampal terminals and their role in spike repolarization and regulation of transmitter release.
J Neurosci 21
: 9585
9597, 2001[Abstract/Free Full Text]
Manzati E, Aguiari G, Banzi M, Manzati M, Selvatici R, Falzarano S, Maestri I, Pinton P, Rizzuto R, Del Senno L: The cytoplasmic C-terminus of polycystin-1 increases cell proliferation in kidney epithelial cells through serum-activated and Ca(2+)-dependent pathway(s).
Exp Cell Res 304
: 391
406, 2005[CrossRef][Medline]
Cai Y, Maeda Y, Cedzich A, Torres VE, Wu G, Hayashi T, Mochizuki T, Park JH, Witzgall R, Somlo S: Identification and characterization of polycystin-2, the PKD2 gene product.
J Biol Chem 274
: 28557
28565, 1999[Abstract/Free Full Text]
Luo Y, Vassilev PM, Li X, Kawanabe Y, Zhou J: Native polycystin 2 functions as a plasma membrane Ca2+-permeable cation channel in renal epithelia.
Mol Cell Biol 23
: 2600
2607, 2003[Abstract/Free Full Text]
Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, Elia AE, Lu W, Brown EM, Quinn SJ, Ingber DE, Zhou J: Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells.
Nat Genet 33
: 129
137, 2003[CrossRef][Medline]
Yu SP, Kerchner GA: Endogenous voltage-gated potassium channels in human embryonic kidney (HEK293) cells.
J Neurosci Res 52
: 612
617, 1998[CrossRef][Medline]
Zhu G, Zhang Y, Xu H, Jiang C: Identification of endogenous outward currents in the human embryonic kidney (HEK 293) cell line.
J Neurosci Methods 81
: 73
83, 1998[CrossRef][Medline]
Berjukow S, Doring F, Froschmayr M, Grabner M, Glossmann H, Hering S: Endogenous calcium channels in human embryonic kidney (HEK293) cells.
Br J Pharmacol 118
: 748
754, 1996[Medline]
Ukomadu C, Zhou J, Sigworth FJ, Agnew WS: muI Na+ channels expressed transiently in human embryonic kidney cells: Biochemical and biophysical properties.
Neuron 8
: 663
676, 1992[CrossRef][Medline]
Moran O, Nizzari M, Conti F: Endogenous expression of the beta1A sodium channel subunit in HEK-293 cells.
FEBS Lett 473
: 132
134, 2000[CrossRef][Medline]
Ye C, Rogers K, Bai M, Quinn SJ, Brown EM, Vassilev PM: Agonists of the Ca(2+)-sensing receptor (CaR) activate nonselective cation channels in HEK293 cells stably transfected with the human CaR.
Biochem Biophys Res Commun 226
: 572
579, 1996[CrossRef][Medline]
Mendez F, Penner R: Near-visible ultraviolet light induces a novel ubiquitous calcium-permeable cation current in mammalian cell lines.
J Physiol 507
: 365
377, 1998[Abstract/Free Full Text]
Gunthorpe MJ, Smith GD, Davis JB, Randall AD: Characterisation of a human acid-sensing ion channel (hASIC1a) endogenously expressed in HEK293 cells.
Pflugers Arch 442
: 668
674, 2001[CrossRef][Medline]
Riccio A, Medhurst AD, Mattei C, Kelsell RE, Calver AR, Randall AD, Benham CD, Pangalos MN: mRNA distribution analysis of human TRPC family in CNS and peripheral tissues.
Brain Res Mol Brain Res 109
: 95
104, 2002[Medline]
Wu X, Babnigg G, Zagranichnaya T, Villereal ML: The role of endogenous human Trp4 in regulating carbachol-induced calcium oscillations in HEK-293 cells.
J Biol Chem 277
: 13597
13608, 2002[Abstract/Free Full Text]
Delmas P: Polycystins, calcium signalling, and human disease.
Biochem Biophys Res Commun 322
: 1374
1383, 2004[CrossRef][Medline]
Garty H, Palmer LG: Epithelial sodium channels: function, structure, and regulation.
Physiol Rev 77
: 359
396, 1997[Abstract/Free Full Text]
Tsiokas L, Arnould T, Zhu C, Kim E, Walz G, Sukhatme VP: Specific association of the gene product of PKD2 with the TRPC1 channel.
Proc Natl Acad Sci U S A 96
: 3934
3939, 1999[Abstract/Free Full Text]
Robitaille R, Garcia ML, Kaczorowski GJ, Charlton MP: Functional colocalization of calcium and calcium-gated potassium channels in control of transmitter release.
Neuron 11
: 645
655, 1993[CrossRef][Medline]
Roberts WM, Jacobs RA, Hudspeth AJ: Colocalization of ion channels involved in frequency selectivity and synaptic transmission at presynaptic active zones of hair cells.
J Neurosci 10
: 3664
3684, 1990[Abstract]
Samaranayake H, Saunders JC, Greene MI, Navaratnam DS: Ca(2+) and K(+) (BK) channels in chick hair cells are clustered and colocalized with apical-basal and tonotopic gradients.
J Physiol 560
: 13
20, 2004[Abstract/Free Full Text]
Volk T, Schwoerer AP, Thiessen S, Schultz JH, Ehmke H: A polycystin-2-like large conductance cation channel in rat left ventricular myocytes.
Cardiovasc Res 58
: 76
88, 2003[Abstract/Free Full Text]
Vandorpe DH, Chernova MN, Jiang L, Sellin LK, Wilhelm S, Stuart-Tilley AK, Walz G, Alper SL: The cytoplasmic C-terminal fragment of polycystin-1 regulates a Ca2+-permeable cation channel.
J Biol Chem 276
: 4093
4101, 2001[Abstract/Free Full Text]