Polycystin-2 Immunolocalization and Function in Zebrafish
Tomoko Obara*,
Steven Mangos*,
Yan Liu*,
Jinhua Zhao*,
Stephanie Wiessner*,
Albrecht G. Kramer-Zucker*,
Felix Olale,
Alexander F. Schier and
Iain A. Drummond*
* Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts; Skirball Institute of Biomolecular Medicine, New York University School of Medicine, New York, New York; and Harvard University, Cambridge, Massachusetts
Address correspondence to: Dr. Iain Drummond, Nephrology Division/MGH 149-8000, 149 13th Street, Charlestown, MA 02129. Phone: 617-726-5647; Fax: 617-726-5669; E-mail: idrummon{at}receptor.mgh.harvard.edu
Received for publication April 28, 2006.
Accepted for publication July 6, 2006.
Polycystin-2 functions as a cation-permeable transient receptorpotential ion channel in kidney epithelial cells and when mutatedresults in human autosomal dominant polycystic kidney disease.For further exploration of the in vivo functions of Polycystin-2,this study examined its expression and function during zebrafishembryogenesis. pkd2 mRNA is ubiquitously expressed, and itspresence in the larval kidney could be confirmed by reversetranscription–PCR on isolated pronephroi. Immunostainingwith anti-zebrafish Polycystin-2 antibody revealed protein expressionin motile kidney epithelial cell cilia and intracellular cellmembranes. Intracellular localization was segment specific;in the proximal nephron segment, Polycystin-2 was localizedto basolateral cell membranes, whereas in the caudal pronephricsegment, Polycystin-2 was concentrated in subapical cytoplasmicvesicles. Polycystin-2 also was expressed in muscle cells andin a variety of sensory cells that are associated with mechanotransduction,including cells of the ear, the lateral line organ, and theolfactory placodes. Disruption of Polycystin-2 mRNA expressionresulted in pronephric kidney cysts, body axis curvature, organlaterality defects, and hydrocephalus—defects that couldbe rescued by expression of a human PKD2 mRNA. In-frame deletionsin the first extracellular loop and C-terminal phosphofurinacidic cluster sorting protein–1 (PACS-1) binding sitesin the cytoplasmic tail caused Polycystin-2 mislocalizationto the apical cell surface. Unlike zebrafish intraflagellartransport protein (IFT) mutants, cyst formation was not associatedwith cilia defects and instead correlated with reduced kidneyfluid output, expansion of caudal duct apical cell membranes,and occlusion of the caudal pronephric nephron segment.
Autosomal dominant polycystic kidney (ADPKD) disease is causedprimarily by mutations in two genes, Polycystin-1 and Polycystin-2.Polycystin-2 belongs to the transient receptor potential (TRP)channel family (1) and can function either as an intracellularcalcium release channel or as a cilia-anchored mechanosensorychannel (2–7). Channel activity measurements have shownthat Polycystin-2 can function as nonselective cation channelboth alone (8) and activated in the presence Polycystin-1 (9).Comparative analysis of Polycystin-2 and homologous TRP channelsin a variety of organisms has provided useful insights intothe function of Polycystin-2 in diverse cellular contexts asa mediator of sensory signaling (1). The Caenorhabditis eleganshomolog pkd2 is localized to sensory neuron cilia, where itplays an essential role in guiding mating behavior (10). TheDrosophila pkd2 homolog is localized to the tip of the spermaxoneme, where it functions to guide sperm to the female eggstorage chamber as a prerequisite for fertilization (11). Musclecontractility also is impaired in Drosophila pkd2 mutants, suggestinga role for Polycystin-2 in intracellular calcium release (12).Sea urchin Polycystin-2 has been proposed to function togetherwith the Polycystin-1–related membrane protein receptorfor egg jelly protein (REJ-1) in sperm to initiate the acrosomereaction as a prelude to fertilization (13). Studies of Polycystin-2expression and function in mouse knockouts show that disruptionof PKD2 results in embryonic kidney cysts, vascular and heartseptal defects, and randomized organ laterality (14,15).
In addition to its broad expression in different species, celltypes, and organs, Polycystin-2 protein is expressed in severaldifferent cell membrane compartments, including apical monociliaand cytoplasmic endoplasmic reticulum (ER)/Golgi membranes,and at the basolateral cell surface (2,3,7,16–18). Thepresence of Polycystin-2 in these different membrane compartmentsindicates that its cellular function is likely to be dependenton its subcellular localization. In cultured mammalian epithelialcells, apical monocilia can function as mechanosensitive flowsensors, where cilia bending results in a spreading wave ofintracellular calcium release (19). The localization of Polycystin-2and its interacting partner Polycystin-1 to apical cilia, coupledwith the ability of Polycystin-2 antibodies to block flow-inducedcalcium release (5), has suggested that Polycystin-2 is a cellsurface channel responsible for initiating flow-induced calciumsignaling. Polycystin-2 also has been localized to motile ciliain the oviduct and the mouse embryonic node (20–22). Inboth kidney epithelia and smooth muscle cells, evidence alsohas been found for Polycystin-2 expressed in ER/Golgi membranesacting as an intracellular calcium release channel (4). In culturedcells, localization of Polycystin-2 to intracellular membranesrequires a C-terminal sequence that includes a cluster of acidicamino acids (DDSEEDDDED) (2,23). This motif is known to bindphosphofurin acidic cluster sorting protein–1 (PACS-1)proteins, which directs retrograde transport and ER retentionof proteins in the secretory pathway (23,24).
The zebrafish has emerged as a useful model of kidney developmentand function owing to the feasibility of disrupting gene expressionin mutants or using antisense oligonucleotides and also to theease of viewing organ phenotypes in living larvae. A zebrafishPKD2 homolog has been identified in a zebrafish insertionalmutagenesis screen (25). Targeting zebrafish pkd2 with translation-blockingmorpholino (MO) oligos results in pronephric kidney cyst formationand other phenotypes (25,26). Analysis of potential cellularmechanisms underlying these phenotypes requires knowledge ofwhere Polycystin-2 is expressed in pronephric epithelial cellsand how, at the level of whole-organ function, defects in Polycystin-2might lead to cyst formation. To explore further the functionof pkd2, we analyzed zebrafish pkd2 mRNA expression patternand protein localization during organogenesis. We found thatwhereas zebrafish pkd2 mRNA is broadly expressed, Polycystin-2protein is localized to specific membranes in the kidney andother tissues, including sensory organs. Using antisense oligos,we also generated new pkd2 loss-of-function MO "alleles" inzebrafish embryos that create internal in-frame deletions. Examinationof these embryos using both physiologic assays of kidney functionand ultrastructural analysis provide evidence that cyst formationin embryos that lack functional Polycystin-2 protein correlateswith altered cell structure in pronephric duct epithelial cellsand changes nephron fluid flow. In-frame internal deletionsin Polycystin-2 protein also provide in vivo evidence that specificprotein domains are required to retain Polycystin-2 proteinin intracellular cell membranes.
Zebrafish Lines
Wild-type TL or TÜAB zebrafish were maintained and raisedas described previously (27). Dechorionated embryos were keptat 28.5°C in E3 solution with or without 0.003% 1-phenyl-2-thiourea(Sigma, St. Louis, MO) to suppress pigmentation and staged accordingto somite number or hours postfertilization (hpf) (27).
Cloning Polycystin-2 and Phylogenetic Analysis
Zebrafish Polycystin-2 cDNA was amplified from 48 hpf totalRNA by reverse transcription–PCR (RT-PCR) using a primerdesign that is based on tblastn searches of Sanger Center zebrafishgenomic sequence using mammalian PKD1 and PKD2 protein sequence.A full-length clone for Polycystin-2 was acquired by 5' and3' rapid amplification of cDNA ends.
In Situ Hybridization and Immunohistochemistry In situ hybridization was performed using standard techniquesas described previously (28). A zebrafish Polycystin-2 antibodywas raised in rabbits using the peptide EKMHHEEVGLGVPDEC coupledto KLH (CoCalico, Philomath, OR). The antibody was affinity-purifiedagainst the immunizing peptide using Sulfo-link resin (Pierce,Rockford, IL) and used at 1:400 dilution. Whole-mount immunocytochemistrywas performed on embryos that were fixed in methanol: DMSO (80:20; 6F [Developmental Studies Hybridoma Bank, University of Iowa],acetylated tubulin mAb 13-6-11B, and anti-zebrafish Polycystin-2)or by 4% paraformaldehyde/PBS fixation (96535 anti-mammalianPolycystin-2). Embryos were blocked in 10% normal goat serumand incubated in primary antibody in 1% DMSO/2% normal goatserum/0.1% Tween-20/PBS overnight at 4°C. After washingin incubation medium, secondary antibodies (Alexa 548, Alexa488; Molecular Probes, Eugene, OR) were used at 1:1000. Washedembryos were cleared in benzyl benzoate:benzyl alcohol and photographedon a Nikon800 fluorescence microscope or on a BioRad Radiance6000confocal fluorescence microscope. For sections, stained embryoswere dehydrated and embedded in JB-4 resin (Polyscience Inc.,Warrington, PA) following the manufacturer’s instructionsand cut at 1 to 4 µm.
MO Antisense Oligonucleotide and mRNA Injections
Wild-type embryos (TUAB) at the one- to two-cell stage weremicroinjected with 0.1 to 0.25 mM antisense MO oligos (GeneTools, Philomath, OR) in 200 mM KCL and 0.1% Phenol Red. Finalantisense MO oligo concentration in the cytoplasm was estimatedto be between 100 and 200 nM.
The sequence of the translation blocking oligonucleotide wasPkd2 MO ATG: 5'-GCTCATCGTGTATTTCTACAGTAAC-3'; the splice donorblocking oligonucleotide sequences were pkd2 MOex3 5'-AATTACTTTCCAGAAGTCCTCCATG-3',pkd2 MOex5 5'-GATCAACCCGTTACCTGACAATACA-3', pkd2 MOex12 5'-CAGGTGATGTTTACACTTGGAACTC-3',pkd2 MOex13 5'-CATCATCATCACCTCCATGACTCCA-3'.
Randomized oligonucleotide (control) was 5'-CCTCTTACCTCAGTTACAATTTATA-3'and showed no effect on development. mRNA rescue experimentswere carried out by co-injecting 10, 30, and 100 pg of in vitrotranscribed human PKD2 mRNA (Message Machine kit; Ambion, Austin,TX) with the MO. Human full-length PKD2 template plasmid wasa gift from Dr. Leo Tsiokas (University of Oklahoma, OklahomaCity, OK). Nested RT-PCR primers are designed from flankingexon coding sequence to confirm MO oligo efficacy and characterizethe altered mRNA splicing products. Amplification of -actinwas performed as a positive control. For MOex3, pkd2ex3F1 TCGTCTTTTGGGTGAGAGCAACA,pkd2ex3R1, CGAATGGTGCCTTGTCCTCATTG, and pkd2ex3F2 TCCTCTTCCTGCTCACCCTCTGC,pkd2ex3R2 TCGTCTCGCAGATCCTCATGGAC. For MOex5, pkd2ex5F1 GGCCCGTTTCTTAACGGCATGTA,pkd2ex5R1 CTCTTGAAGTAGCGCAGCCGATG, pkd2ex5F2 GGCCCGTTTCTTAACGGCATGTA,and pkd2ex5R2, CTGGAGACATAGCGGAGCAGACG. For MOex12 and MOex13,pkd2ex9F1 GCACCTTTCAGGCCTGCATTTTC, pkd2ex14R1 GGAGTGGCCTGATGATGATGGTG,pkd2ex9F2 CACGCAGTTCCGGATCATACTGG, and pkd2ex14R2 CCAGCTCGTCCCTAACCAACCTG.
Histologic and Ultrastructural Analysis
For histology analysis, embryos were fixed in 1% paraformaldehyde,1.5% glutaraldehyde, 70 mM NaPO4 (pH 7.2), and 3% sucrose; embeddedin glycolmethacrylate (JB-4 resin; Polyscience, Inc.); and sectionedat 4-µm sections. Sections were stained in methylene blue/azureII (28) and mounted with Permount. Embryos were prepared forelectron microscopy by previously published protocols (28).
High-Speed Videomicroscopy
1-Phenyl-2-thiourea–treated embryos were put in E3 eggwater that contained 40 mM 2,3-butanedione monoxime (Sigma)for 5 min to stop the heart beat and then changed to 20 mM 2,3-butanedionemonoxime–containing egg water for observation. The embryosthen were analyzed using a x40/0.55 water immersion lens ona Zeiss Axioplan microscope (Zeiss, Germany) equipped with ahigh-speed Photron FastCAM-PCI 500 videocamera (Photron, SanDiego, CA). Image acquisition of beating cilia was 250 framesper second and 1088 frames total per take by Photron FastCAMversion 1.2.0.7 (Photron). Image processing was done using Photoshop7.0 (Adobe Systems, Mountain View, CA), and movies were compiledin Graphic Converter v.4.5.2 (Lemke Software, Peine, Germany).
Fluorescent Dye Injection and Fluorescence Videomicroscopy
For urine excretion assays, a 5% solution of tetramethylrhodamine-conjugated70-k molecular weight dextran (Molecular Probes) was injectedinto the common cardinal vein of 3.0- to 3.5-dpf embryos thatwere anesthetized with 0.2 mg/ml tricaine (3-aminobenzoic acidethyl ester; Sigma) in egg water; these then were examined usinga x40/0.55 water immersion lens on a Zeiss Axioplan microscopeequipped with a MTI SIT68 fluorescence camera. The video wasrecorded in real time with a Panasonic PV-8400 tape recorder.Digitization was done using SonicMyDVD Version 3.5.2 software(Adaptec, Milpitas, CA); still frames were captured using QuickTimev.6.5.1, and movies were recompiled by Graphic Converter (LemkeSoftware).
Expression of Zebrafish Polycystin-2 and Immunolocalization in Developing Embryos
Polycystin-2 has been shown to be widely expressed in mammalianembryos and to function in multiple cell types (3,7,14,16–18,29).To examine pkd2 mRNA expression in zebrafish embryogenesis,we performed whole-mount in situ hybridization on embryos fromgastrulation through free-swimming larval stages of development.pkd2 mRNA was ubiquitous and observed at all stages of developmentby whole-mount in situ hybridization, including gastrulation,somatogenesis, and 48 hpf (Figure 1, A through D), and in earlylarval stages (72 hpf; data not shown). Expression of pkd2 mRNAin pronephric tubules and ducts was confirmed by RT-PCR on isolatedpronephric duct RNA (Figure 1E). RT-PCR also demonstrated thatzebrafish pkd2 mRNA is widely expressed in adult tissues, includingthe brain, eye, heart, gut, spleen, kidney, and gonad (datanot shown).
Figure 1. Expression of pkd2 mRNA during embryogenesis. By whole-mount in situ hybridization, pkd2 is expressed ubiquitously during epiboly (A), at the 18-somite stage (B), at 24 h postfertilization (hpf; C) and at 48 hpf (D). Reverse transcription–PCR (RT-PCR) on RNA from isolated pronephric ducts (E) confirmed expression of pkd2 in pronephroi.
Previous studies of mammalian Polycystin-2 protein localizationdemonstrated expression in intracellular ER/Golgi membranesand in apical, nonmotile cilia of kidney epithelia and mousenode cells (3,18,21,30). To examine the subcellular Polycystin-2protein distribution in zebrafish, we generated an antipeptideantibody against the N-terminal cytoplasmic zebrafish Polycystin-2protein sequence EKMHHEEVGLGVPDEC and purified it by antigenaffinity chromatography. Whole-mount immunostaining revealedstrong expression of Polycystin-2 in the trunk region embryosat 24 and 48 hpf (Figure 2A). Expressing cells included muscleand the pronephric duct. Preincubation with immunizing peptide(Figure 2B) or blocking expression of endogenous Polycystin-2with a MO oligo targeting the initiator ATG completely abolishedanti–Polycystin-2 immunoreactivity (Figure 2C), demonstratingspecificity of our antibody. Also, no staining was observedwith preimmune serum or in the absence of primary antibody (datanot shown). An enlarged view of the anterior segment of a singlepronephric duct revealed that Polycystin-2 immunostaining couldbe seen associated with the basolateral membrane as well ason lumenal cilia (Figure 2D). Cilia that arose from both multiciliatedcells and singly ciliated cells were positive for Polycystin-2(data not shown). In histologic sections, Polycystin-2 alsowas localized to basolateral cell membranes of pronephric ductcells in the anterior (proximal) nephron segment (Figure 2E).It is interesting that Polycystin-2 subcellular localizationin the more posterior pronephric duct shifted to cytoplasmicvesicles that ringed the nucleus and showed a concentrationnear the apical cell surface (Figure 2F). Basolateral cell membranesof caudal pronephric duct cells were largely negative for Polycystin-2(Figure 2G). The presence of Polycystin-2 protein in adult zebrafishkidney was assayed by Western blotting. Our anti–Polycystin-2antibody detected a single protein in lysates of whole adultkidney that migrated at approximately 115 kD (Figure 2H). Thisresult confirms expression of Polycystin-2 in adult kidney andfurther establishes the specificity of our antibody.
Figure 2. Immunolocalization of Polycystin-2 in the pronephric kidney. (A) Expression of Polycystin-2 protein in the trunk of a 48-hpf embryo viewed in whole mount is strong in muscle (*) and the pronephric duct (arrowheads). (B) Immunizing peptide preincubation control for antibody staining shows no signal in a similar trunk region (*muscle; arrowheads, pronephric duct). (C) Control for antibody specificity using ATG morpholino (MO) blockade of endogenous protein translation shows no expression in the trunk region (*muscle; arrowheads, pronephric duct). (D) Z-series projection of Polycystin-2 immunofluorescence in anterior pronephric duct shows expression in cilia and associated with basolateral cell membranes and infoldings (arrows) in a whole mount–stained 2.5-d embryo. (E) Cross-sections of the anterior pronephric duct show Polycystin-2 expression associated with basolateral cell membranes (arrows) and apical cilia. (F) Polycystin-2 immunofluorescence in the posterior pronephric duct is punctate and distributed throughout the cells with a concentration of staining near the apical surface. (G) Sections of the posterior pronephric duct in the cloaca region show expression of Polycystin-2 in subapical membrane vesicles and reduced expression in basolateral membranes (arrows). (H) Western blot of adult zebrafish kidney reacted with anti-zebrafish PKD2 antibody reveals a single band migrating at approximately 115 kD.
To clarify the subcellular distribution of Polycystin-2 in anteriorand posterior nephron segments, we double stained embryos withPolycystin-2 and anti-acetylated tubulin to highlight apicalcilia or with anti-NaK ATPase subunit (6F) to highlight basolateralmembranes. Confocal images of whole-mount stained embryos showedthat in the anterior pronephros, Polycystin-2 was associatedwith basolateral membranes and with bundles of apical ciliathat were strongly positive for anti-acetylated tubulin (Figure 3,A through C). In the posterior duct, Polycystin-2 immunostainingwas more punctate, suggesting expression on cytoplasmic vesicles(Figure 3D). Polycystin-2 also was associated with single apicalcilia and was most strongly localized to the basal portion ofcilia and often absent from cilia tips (Figure 3, E and F).The anti-NaK ATPase 1 subunit antibody 6F uniformly labels thebasolateral surfaces of pronephric duct cells (Figure 3H). Ina tangential optical section of the anterior pronephric duct,Polycystin-2 immunostaining also was associated with the basolateralsurface but appeared more punctate compared with 6F staining(Figure 3, G and I). In the posterior duct, confocal imagesof Polycystin-2 staining in histologic sections showed someareas of co-localization with 6F staining near apical lateralmembranes (Figure 3, J through L) but was notably reduced nearbasal cell surfaces (Figure 3, J and K, arrows). As in anteriorsegments, lumenal cilia were positive for Polycystin-2 but negativefor 6F (Figure 3L). Segment-specific subcellular localizationof Polycystin-2 in the pronephric duct raises the possibilitythat Polycystin-2 may perform distinct functions depending onthe cellular context in which it is expressed.
Figure 3. Nephron segment–specific distribution of Polycystin-2 in basolateral membranes and cilia. (A through C) The anterior pronephric duct. Polycystin-2 (A; green) and acetylated tubulin (B; red) immunofluorescence in confocal sections. (C) Merged image of A and B. Anterior duct Polycystin-2 is present associated with basolateral membranes (arrows in A) and a lumenal bundle of cilia. (D through F) The posterior pronephric duct. Polycystin-2 (D; green) and acetylated tubulin (E; red) immunofluorescence in confocal sections. (F) Merge of D and E shows accumulation of Polycystin-2 in intracellular vesicles and at the base of cilia (arrows). (G through I) The anterior pronephric duct. (G) Tangential confocal section through the basolateral membranes shows a concentration of punctate Polycystin-2 expression in a whole mount–stained 2.5-d embryo. (H) Basolateral membranes of the anterior duct stain uniformly with the monoclonal 6F against the NaK ATPase 1 subunit. (I) Merge of G and H shows that Polycystin-2 and the NaK ATPase show areas of co-localization and some distinct areas of punctate expression. (J through L) The posterior pronephric duct. (J) Cross-section of the duct shows punctate Polycystin-2 immunofluorescence in lateral and apical membranes but absence of expression in basal cell surfaces. A lumenal cilium also is positive for Polycystin-2. (K) NaK ATPase immunofluorescence on basolateral membranes. (L) Merge of J and K.
Expression of Polycystin-2 in Extrarenal Tissues
Polycystin-2 expression was observed in several nonkidney tissues,including muscle cells (Figure 4, A and B) and the lining ofthe brain ventricles (Figure 4C), and in sensory structures,including the olfactory placodes (Figure 4D), the ear (Figure 4E),and the lateral line organs (Figure 4F). In muscle, Polycystin-2was strongly expressed in cell membranes (Figure 4A) and ina repeating sarcomeric pattern (Figure 4B), suggesting thatit may function in sarcoplasmic reticulum membranes. In thebrain ventricle, expression was detected in apical cilia (Figure 4C).In sensory organs, Polycystin-2 was expressed in olfactory placodes(Figure 4D), the ear (Figure 4E), and the lateral line organ(Figure 4F). In the lateral line organs, Polycystin-2 was expressedin the apical membrane of ciliated hair cells but not in thecilia themselves (Figure 4F, inset).
Figure 4. Immunolocalization of Polycystin-2 in nonkidney organs. (A) At 56 hpf, muscle cell membranes of the trunk myotomes are positive for Polycystin-2 in confocal sections. (B) Polycystin-2 expression also is present in repeating, sarcomeric bands on intracellular muscle fibers. (C) Ependymal cell cilia in the brain ventricles are positive for Polycystin-2 (arrows and inset) in histologic sections. (D) The olfactory placode cell membranes are strongly positive for Polycystin-2 (arrow) in histologic sections. (Inset) Confocal section of the olfactory placode showing concentration of Polycystin-2 immunoreactivity in apical membranes of olfactory placode cells. (E) Epithelial cells of the ear show apical staining for Polycystin-2 (Inset) Higher magnification view of ear cells showing Polycystin-2 immunoreactivity in apical membranes and vesicles. (F) Cells of the lateral line organ are strongly positive for Polycystin-2 expression (Inset) Higher magnification view of lateral line organ cells in the central part of this structure showing Polycystin-2 expression.
Disruption of Polycystin-2 Function with Antisense MO Oligos
Previous studies demonstrated that loss of Polycystin-2 functionin zebrafish results in pronephric cyst formation and defectsin left–right asymmetry (25,26). To assess how deletionof specific Polycystin-2 domains may affect the in vivo functionsof Polycystin-2, we generated multiple internal deletion allelesof Polycystin-2 by disrupting mRNA splicing with antisense MOoligos targeting exon donor sites. Two different in-frame deletionsin the first extracellular loop (Figure 5, A, B and L) wereproduced by targeting pkd2 exon 3 and exon 5 splice donor sites.Targeting the exon 12 splice donor site resulted in failureto splice intron 12 and read-through to an immediate stop codonin intron 12, producing a predicted C-terminal truncation allelejust after a conserved PACS-1 binding motif (Figure 5, A, Band L). Targeting the exon 13 splice site donor resulted inan in-frame deletion of exons 12 and 13 that contain the PACS-binding,ER retention motif (Figure 5, B and L). MO injection effectivelyeliminated normal pkd2 mRNA for the first 2 d of development;recovery of wild-type message to roughly equal amounts to deletedmRNA was observed by 3 dpf as shown for MOex3 in Figure 5C.All splice donor site–blocking MO-injected embryos exhibiteda similar range of phenotypes: Morphant embryos developed dorsalbody axis curvature, hydrocephalus, and pronephric kidney cystsby 2.5 d of development (Figure 5, F through K) compared towild-type (Figure 5, D and E). A MO targeting the pkd2 AUG initiationcodon produced a similar pleiotropic phenotype (data not shown).Consistent with previous reports, disruption of zebrafish pkd2expression also resulted in defects in left–right asymmetry.Heart looping was randomized with roughly 30% normal, 50% inverted,and 20% midline. In situ hybridization using CMLC2 as a markerof the heart chambers and fkd2 and insulin as markers of theliver and pancreas, respectively, revealed that all three organswere abnormally positioned with respect to normal left–rightsitus (Figure 6).
Figure 5. Disruption of pkd2 expression with splice donor antisense MO oligonucleotides. (A) Diagram of Polycystin-2 protein in the cell membrane showing membrane topology and C-terminal motifs associated with Polycystin-2 function. (B) Targeting splice donor sites of exons 3, 5, 12, and 13 with antisense MO oligonucleotides resulted in the production of internal in-frame deletions (exons 3, 5, and 13 MO) and a C-terminal truncation (exon 12 MO). Transmembrane domains of Polycystin-2 are depicted in gray. (C) The efficacy of the injected MO was quantified at 24-, 48-, and 72-h intervals by RT-PCR. Polycystin-2 exon 3 donor MO (MOex3) caused a 39–amino acid in-frame deletion of part of the first transmembrane domain as detected by the presence of a smaller, internally deleted RT-PCR product. Some recovery of normal Polycystin-2 mRNA was observed by 72 hpf. Similar results were observed for all splice donor targeted MO. (D) Control embryos at 72 hpf. (E) Histologic section of normal pronephros at 72 hpf. (F) MOex3-injected embryo showing axis curvature and hydrocephalus (arrow; 97%, 941 of 967 embryos). (G) Histologic section showing cystic pronephric tubules (*) in MOex3-injected embryo. (H) MOex12-injected embryos and section (I) of the cystic pronephros. (J) MOex13-injected embryos showing severe axis curvature and kidney cysts (arrow). (K) Histologic section of embryo in J showing kidney cyst (*). (L) Antisense MO deletions in the Polycystin-2 protein sequence predicted on the basis of nucleotide sequence of RT-PCR products amplified from MO-injected embryos. In-frame deletions are shown in gray for MOex3, MOex5, and MOex13. MOex12 induced a nonsplicing event that resulted in a stop codon immediately after exon 12 in the cDNA (shown in red *). Transmembrane domains (tm) and the PKD1 binding homology domain are highlighted in brown. Membrane targeting motifs in the cytoplasmic C-terminus including the phosphofurin acidic cluster sorting protein–1 (PACS-1)-binding acidic cluster are underlined.
Figure 6. Polycystin-2 function in left–right asymmetry. (A) Expression of cardiac myosin light chain 2 (cmlc2) in control embryos (top left) demonstrates normal positions of the heart ventricle (v) and atrium (a) relative to the embryo midline. Polycystin-2 MOex3 caused inversion of left–right axes in 50% of injected embryos (top left). Forkhead2 (fkd2) and insulin gene expression revealed similar inversion of liver (li) and pancreas (p) situs, respectively (bottom). (B) Quantification of left–right asymmetry defects. Wild-type embryos (wt) show normal situs in most all cases with a low level of background laterality defects. Polycystin-2 MOex3-injected embryos show a high degree of left–right axis inversion (approximately 50%) as well as midline organ position for the heart, liver, and pancreas.
Pronephric Kidney Cyst Formation and Rescue with Human PKD2 mRNA
To establish specificity of MO effects and to test for conservationof Polycystin-2 function, we determined whether pkd2 MO phenotypescould be rescued by co-injection of a synthetic human PKD2 mRNA.As shown in Figure 7, embryos that were co-injected with pkd2MOex3 and human PKD2 mRNA were morphologically normal in termsof both kidney structure and axis curvature (Figure 7, C andH). Intermediate amounts of human PKD2 mRNA caused partial rescueof both phenotypes (Figure 7, B and G). Staining injected embryoswith a mammalian-specific anti–Polycystin-2 antibody confirmedbroad expression of the exogenous rescuing mRNA (Figure 7, Ithrough K). The data indicate that the effects of the spliceblocking MO are specific to the PKD2 mRNA and that the humanPolycystin-2 protein can functionally replace the zebrafishgene in vivo.
Figure 7. Rescue of pkd2MOex3 phenotype with human PKD2 mRNA co-injection. (A and E) pkd2 MOex3-injected embryo showing axis curvature and pronephric cysts in cross-section (97%; 617 of 638 injected embryos). (B and F) Co-injection of 30 pg of human PKD2 mRNA with MOex3 MO results in partial rescue of cyst phenotype (arrow in F; 98%, 571 of 583 injected embryos). (C and G) Co-injection with 100 pg of human PKD2 mRNA completely rescues cyst phenotype (arrow in G; 99%, 728 of 733 embryos). (D and H) Injection of human PKD2 mRNA alone has no effect on normal embryos (641 embryos). (I) Polyclonal anti-PKD2 antibody 96526 recognizes mouse and human Polycystin-2 but not zebrafish Polycystin-2 (uninjected wild-type embryo). (J) Embryo injected with human PKD2 mRNA shows broad expression of the exogenous rescuing mRNA. (K) Mouse Polycystin-2 peptide antigen preincubation blocks all 96526 antibody staining, demonstrating specific immunoreactivity of the 96526 antibody.
Internal Polycystin-2 Peptide Deletions Alter Subcellular Localization
The in-frame internal deletion pkd2 mRNA that we generated byMO-directed missplicing would be predicted to encode proteinswith deletions in discrete protein domains. MOex3 and MOex5would generate 37 and 47 amino acid deletions, respectively,in the Polycystin-2 first extracellular loop while leaving neighboringtransmembrane spanning sequences intact. MOex13 would generatea larger, 104 amino acid deletion in the cytoplasmic C-terminusencompassing the conserved PACS binding, ER/Golgi retentionmotif (23), and potentially other functionally important motifswhile leaving the C-terminal EF-hand and putative PKD1-interactingdomains (31,32) unaffected. Because deletion of the Polycystin-2motifs might be expected to result in altered subcellular proteintrafficking and localization (2,23), we examined morphant embryosfor the localization of the altered Polycystin-2 protein. Incontrast to wild-type Polycystin-2 protein, which was concentratedin basolateral cell membranes in anterior duct cells (Figure 8A),Polycystin-2 that lacked either exon 5 sequences of the firstextracellular loop or C-terminal exons 12 and 13 was concentratedin apical membranes of pronephric duct cells and strongly reducedor absent from internal and basolateral cell membranes (Figure 8,B and C).
Figure 8. Apical mislocalization of MO-altered Polycystin-2 proteins. (A) Wild-type Polycystin-2 is concentrated in basolateral membranes of the anterior pronephric ducts (arrows, basolateral cell surface) in histologic sections. (B) MOex5-injected embryo showing a shift in immunoreactivity of altered (in-frame deletion in the first extracellular loop) Polycystin-2 from basal to apical cell membranes. (C) MOex13-injected embryo showing absence of basolateral staining and concentration of Polycystin-2 immunoreactivity in apical and lumenal membranes.
Potential Mechanisms of Pronephric Cyst Formation
Because previous studies suggested that the Polycystin-1/2 complexmay control cell division (33), we examined pronephric tubulesand ducts of morphant embryos for evidence of an increase incell number. In cross-section, both wild-type and pkd2 morphantducts were made up of four to five cells; no differences incell number between wild-type and pkd2 MO-injected embryos atearly stages of cyst formation were observed (data not shown).Kidney cyst formation in zebrafish and in mammals also has beenassociated with a disruption of apical cilia function in tubuleepithelial cells (25,34). When cilia were visualized with anti-acetylatedtubulin immunofluorescence in pkd2MO-injected embryos, no differencesin cilia length or orientation were observed (data not shown).Cilia in the zebrafish pronephros are motile and contributeto overall fluid movement in the pronephros (34); we thereforeasked whether the mechanism of cyst formation might involvea reduction or loss of cilia motility. No defects in pronephriccilia motility were observed by high-speed video microscopyof pkd2MO-injected embryos (data not shown). The data indicatethat cyst formation in the pronephros of pkd2 morphants is notlikely to be due to an early increase in cell proliferationor a loss of cilia structure or motility.
In work on related zebrafish pronephric cyst mutants, we haveobserved that cyst formation can result from reduced fluid flowor nephron obstruction (34). To establish whether fluid flowmight be affected in embryos that lack functional Polycystin-2,we assayed fluid output at the cloaca using rhodamine dextranas a fluid tracer. Vascular injection of fluorescence dextranresults in glomerular filtration of this fluid tracer and appearanceof a fluorescence "jet" of urine output at the cloaca in wild-typeembryos (Figure 9, A and B). Fluorescence fluid output at thecloaca was not observed in any pkd2MO-injected embryos thatdeveloped cysts (Figure 9, C and D; n = 5), whereas all wild-typeembryos showed fluorescence fluid output at the cloaca (Figure 9,A and B; n = 9). This suggested that nephron fluid flow mightbe significantly reduced in embryos that lack Polycystin-2 function,possibly as a result of a functional or physical obstructionof the duct. Examination of microscopic images of live fishdid in fact suggest that the posterior pronephric duct of morphantembryos may be partially occluded, because it was not possibleto visualize the duct lumen structure in these images (Figure 10,B and C) compared with similar images of wild-type embryos (Figure 10A).Further examination of the distal duct ultrastructure by electronmicroscopy revealed that in wild-type embryos, the caudal pronephricduct lumen is narrow but clearly discernible in all wild-typeembryos examined (n = 3; Figure 10D). In contrast, the ductlumen in similar segments of pkd2MO-injected embryos was occludedby the apical cytoplasm of duct epithelial cells (Figure 10E).Limiting apical cell junctions were clearly visible in pkd2MOlarvae; however, the apical cytoplasm and apical cell surfacesof duct epithelial cells were seen to be abutting, coalescingaround profiles of lumenal cilia (Figure 10E). The results suggestthat Polycystin-2 may be required to regulate apical cell cytoskeletonor otherwise maintain lumen patency in the posterior pronephricducts.
Figure 9. Reduction in pronephric fluid output in pkd2 morphants. (A and B) Pronephric fluid output detection at the cloaca using rhodamine dextran as a fluid tracer in wild-type embryos at 72 hpf. Appearance of a fluorescence "jet" of urine output at the cloaca is observed (arrowhead in B). (C and D) Polycystin-2 MOex3-injected embryos at 72 hpf show a significant reduction in fluid output at the cloaca (arrowhead in D).
Figure 10. Structural alterations in the distal pronephric nephron segment of pkd2 morphants. (A) Differential interference contrast images of the cloaca region of the pronephric duct in living, 3-dpf wild-type embryos show a patent lumen extending to the cloaca. (B) Polycystin-2 MOex3-injected embryos show an apparent collapse of the distal duct lumen. (C) Lumenal distension (*) immediately anterior to an area of duct occlusion (arrowhead in C) in a Polycystin-2 MOex3-injected embryo. Cilia beat and length appeared normal in areas of lumenal distension (data not shown). (H) Electron micrograph cross-section of the wild-type distal pronephric duct showing a patent duct lumen (*). For reference, cell basement membrane is denoted with arrowheads. (I) A similar region of the pronephric duct in a Polycystin-2 MOex3-injected embryos appears occluded by extended apical cytoplasm of duct epithelial cells. Five apical adherens junctions of the MOex3 duct epithelial cells can be seen (white arrowheads); however, the apical membranes of these cells abut with opposing cells, occluding the duct lumen. Black arrowheads, basement membrane.
Because of the ease of observation, genetic manipulation, andthe conservation of gene function, the zebrafish has emergedas a useful model system for studies of vertebrate organogenesisand nephrogenesis. The potential to model disease mechanismsin the zebrafish motivated us to explore the function of Polycystinsin the pronephros. We and others find that Polycystin-2 playsa critical role in zebrafish kidney and brain development andin regulating organ situs (25,26). How Polycystin-2 loss offunction might cause cyst formation in the pronephros and wherePolycystin-2 is expressed in a pronephric epithelial cell werenot known. In work presented here, we demonstrate that Polycystin-2is present in multiple cell membrane systems in the zebrafishkidney, including basolateral cell membranes, intracellularvesicles, and cilia membranes. We provide in vivo evidence thatprotein domains in the first extracellular loop and C-terminalsequences that include a PACS-binding domain (23) are requiredto retain Polycystin-2 protein in intracellular membrane systems.Loss of Polycystin-2 function did not lead to defects in ciliafunction or altered cell proliferation but instead reduced fluidoutput from the pronephros and altered cell morphology in themost distal segment of the pronephros. Expanded apical cytoplasmand, in a majority of cases, occlusion of the pronephric ductssuggest the possibility of an obstructive mechanism of cystformation in the zebrafish pronephros.
Polycystin-2 Localization and Function in the Pronephros
Polycystin-2 has been shown to function both as a mechanosensorychannel in apical cilia and as an intracellular calcium releasechannel in intracellular membranes (2–7). In the zebrafish,we find that Polycystin-2 is localized to both cilia and intracellularmembranes in kidney epithelial cells, suggesting that it couldfunction in both cell compartments.
Although uniformly present in cilia throughout the pronephricnephron, Polycystin-2 was localized to distinct membranes inproximal versus distal pronephric duct cells. Presence of Polycystin-2in anterior/proximal duct basolateral cell membranes would beconsistent with similar reports of Polycystin-2 localizationin mammalian kidney epithelia (2,3). In some of our images,however, Polycystin-2 expression appeared more punctate, suggestingthat in the anterior duct, some Polycystin-2 also may be expressedin vesicles that are closely associated with the basolateralmembrane as opposed to inserted in the basolateral membraneitself. Subcellular localization of Polycystin-2 in more distalnephron segments in vivo has been less well characterized. Ourresults show that cells of the distal zebrafish pronephros uniquelyexpress Polycystin-2 in vesicles that are concentrated in theapical cytoplasm and in apical cilia, similar to mouse innermedullary collecting duct cells in culture (35). By electronmicroscopy, we found that this region of the cytoplasm seemsto be rich with small vesicular structures that could containPolycystin-2 protein. One implication of these results is thatPolycystin-2 localization is as much dependent on differentprotein trafficking systems’ functioning in particularcell types as it is on cis-motifs that are present in the proteinitself. In addition, it is possible that the some of the differencesin Polycystin-2 subcellular localization could reflect a redistributionof Polycystin-2–containing vesicular structures in posteriorversus anterior cells. Further studies by immunoelectron microscopymay help to resolve these possibilities.
Roles for Polycystin-2 Domains in Subcellular Localization
Several different protein trafficking motifs in Polycystin-2now have been described. These motifs include an N-terminalsequence that is required for Polycystin-2 cilia localization(36), an N-terminal GSK-3 phosphorylation site that favors localizationin lateral cell membranes similar to E-cadherin and ZO-1 (37),and a C-terminal acidic cluster/PACS-binding domain that promotesretention of Polycystin-2 in the ER/Golgi membranes (23). Theexon 12/13 MO deletion allele (MOex13) that we generated wouldbe predicted to encode a protein that lacks the ER retentionmotif/acidic cluster from the cytoplasmic C-terminus while preservingthe more C-terminal sequences. Consistent with results fromcell culture studies, this variant protein was detected exclusivelyin apical cell membranes and/or lumenal cilia of zebrafish anteriorpronephric duct cells in vivo, as opposed to the wild-type proteinthat was evenly distributed between the cilia and basolateralmembranes. Because even complete deletion of the cytoplasmictail of mammalian Polycystin-2 does not abolish its channelactivity (38), it is likely that some channel activity may remainassociated with the MOex13 Polycystin-2 variant protein as wellas with the MOex12 variant that produced a C-terminal truncation(V777X). However, because both MO caused pronephric cyst formation,it is clear that whatever channel activity may remain in thesevariants is not sufficient for normal Polycystin-2 function,as is the case for similar human PKD2 mutations that are associatedwith ADPKD (38). Further studies of zebrafish Polycystin-2 pointmutants and biophysical studies of channel variants will berequired to assess their function critically in the pronephros.
Potential Functions for Polycystin-2 in the Distal Pronephric Duct
The reduction in fluid output and from the pronephros of embryosthat lacked Polycystin-2 despite the presence of normally functioningrenal cilia prompted us to examine Polycystin-2–expressingnephron segments for any evidence of obstruction to lumenalfluid flow. The ultrastructure of the posterior duct lumen incystic larvae suggests that the posterior duct is completelyoccluded by extension of apical cytoplasm of duct cells. Onefunction of pkd2 in zebrafish therefore may be to maintain orspecifically regulate the distal pronephric duct lumen diameter.When its expression is disrupted, apical membranes narrow theposterior duct lumen, causing a reduction in fluid flow, whichcould result indirectly in cyst formation in more anterior,proximal nephron segments. This interpretation is supportedby our previous findings that complete occlusion of the posteriorpronephric duct in zebrafish larvae by mechanical wounding issufficient to cause cysts to form rapidly in the anterior nephronsegments adjacent to the glomerulus, presumably by a build-upof fluid back pressure (34). In addition, disruption of genesthat are required in zebrafish for caudal body axis developmentcan result in failure of distal pronephric duct extension andfailed cloacal fusion with the exterior, with subsequent cystdevelopment in anterior, proximal, pronephric nephron segments(39). In this light, cyst development in zebrafish pronephroicould be viewed as similar to human multicystic dysplastic kidneydisease or fetal obstructive disorders in which distal obstructionand feedback fluid pressure are sufficient to distend proximaltubules and glomeruli (40,41). Polycystin-2, however, is associatedin humans with ADPKD, in which the existence of cysts with seeminglypatent connections to the ureter has discounted the idea thatobstruction plays a major role in ADPKD (42,43). Although furtherstudies will be required to clarify the relationship of ourresults to Polycystin-2 function in the mammalian kidney, ourstudies show that Polycystin-2 in zebrafish is required to maintainlumen patency in the distal portion of the pronephric duct andthat a "functional obstruction" is the most likely cause ofcyst formation in the pronephros.
How Polycystin-2 might regulate distal pronephric duct lumensize is unclear. One possibility is that Polycystin-2 normallynegatively regulates the amount of membrane that is deliveredto the apical cell surface and, when absent, allows excess apicalmembrane insertion. Excess apical membrane insertion in a tubulethat is fixed in overall diameter by its basement membrane couldresult in expansion of the cell apical domain to the point atwhich it occludes the lumen. Evidence for variation in the amountor rate of apical membrane delivery being part of a mechanismfor the formation of epithelial cysts has been demonstratedin Drosophila salivary tubes (44). Alternatively, Polycystin-2could regulate the structure of the apical cytoskeleton in posteriorduct cells. Mammalian Polycystin-2 is known to interact withactin cytoskeleton–associated or regulatory proteins,including hax-1, CD2AP, troponin, and tropomyosin (45–48).Polycystin-2 also has been shown to interact with mDia1, a RhoGTPase effector protein that regulates actin polymerization(49). It is possible that Polycystin-2, acting as a calciumentry channel in response to lumenal flow or as an intracellularrelease channel in the apical cytoplasm, may play some rolein maintaining the rigidity of the subapical actin cytoskeleton.
Potential Roles for Polycystin-2 in Pronephric Cilia
Polycystin-2 in mammalian kidney tubules has been localizedto nonmotile, "9 + 0" apical cilia, and evidence from in vitrocell culture studies has shown that nonmotile cilia can actas mechanosensors of fluid flow (5,19). The presence of Polycystin-2in pronephric cilia, which, unlike "9 + 0" primary cilia oncultured mouse epithelial cells, are "9 + 2" and motile (34),broadens the potential roles for Polycystin-2 in cilia and renalepithelia. Polycystin-2 also has been localized to motile ciliain the female reproductive tract and the mouse embryonic node(20–22), which, taken together with our work, indicatesthat Polycystin-2 function may not be limited to nonmotile cilia.Although we cannot demonstrate any morphologic defects in pronephriccilia or any difference in cilia beat rate in pkd2 morphants,it remains possible that Polycystin-2 function in motile ciliacould be related to mechanosensory signaling. Motile cilia havebeen shown to relay mechanosensory information, signaling changesin membrane potential in response to increased resistance tobeating or initiating or reversing cilia beat in response totouch or pressure (50). The TRP channel TRPV4 is localized tomotile cilia in the mammalian oviduct and has been shown tosignal changes in cilia beat frequency in response to fluidviscosity changes (20). Motile cilia in the invertebrate statocyst,an organ that is associated with sensing orientation, respondto interference with cilia beat and relay this information aschanges in membrane potential (51). It is not known whetherPolycystin-2 in motile pronephric cilia could contribute tocilia signaling. However, the presence of Polycystin-2 in multipletypes of cilia and ciliated sensory organs in zebrafish larvaesuggests that the fish will be a useful model to explore furtherthe in vivo functions of Polycystin-2.
Acknowledgments
This work was supported by National Institutes of Health grantsDK53093 and DK54711 to I.A.D. and GM56211 to A.F.S. A.F.S. isan Irma T. Hirschl Trust Career Scientist and an EstablishedInvestigator of the American Heart Association. T.O. is supportedin part by a PKD foundation grant 69a2r.
We thank Mary McKee for assistance with electron microscopyand Jing Zhou, Yiqiang Cai, and Stephan Somlo for Polycystin-2antibodies.
Footnotes
Published online ahead of print. Publication date availableat www.jasn.org.
T.O. and S.M. contributed equally to this work.
T.O.'s current affiliation is Department of Medicine, MetroHealthMedical Center, Case Western Reserve University, Cleveland,Ohio. A.G.K.-Z.'s current affiliation is Renal Division, UniversityHospital Freiburg, Zentrale Klinische Forschung, Freiburg, Germany.
Clapham DE: TRP channels as cellular sensors.
Nature 426
: 517
–524, 2003[CrossRef][Medline]
Cai Y, Maeda Y, Cedzich A, Torres VE, Wu G, Hayashi T, Mochizuki T, Park JH, Witzgall R, Somlo S: Identification and characterization of polycystin-2, the PKD2 gene product.
J Biol Chem 274
: 28557
–28565, 1999[Abstract/Free Full Text]
Foggensteiner L, Bevan AP, Thomas R, Coleman N, Boulter C, Bradley J, Ibraghimov-Beskrovnaya O, Klinger K, Sandford R: Cellular and subcellular distribution of polycystin-2, the protein product of the PKD2 gene.
J Am Soc Nephrol 11
: 814
–827, 2000[Abstract/Free Full Text]
Koulen P, Cai Y, Geng L, Maeda Y, Nishimura S, Witzgall R, Ehrlich BE, Somlo S: Polycystin-2 is an intracellular calcium release channel.
Nat Cell Biol 4
: 191
–197, 2002[CrossRef][Medline]
Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, Elia AE, Lu W, Brown EM, Quinn SJ, Ingber DE, Zhou J: Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells.
Nat Genet 33
: 129
–137, 2003[CrossRef][Medline]
Newby LJ, Streets AJ, Zhao Y, Harris PC, Ward CJ, Ong AC: Identification, characterization, and localization of a novel kidney polycystin-1-polycystin-2 complex.
J Biol Chem 277
: 20763
–20773, 2002[Abstract/Free Full Text]
Scheffers MS, Le H, van der Bent P, Leonhard W, Prins F, Spruit L, Breuning MH, de Heer E, Peters DJ: Distinct subcellular expression of endogenous polycystin-2 in the plasma membrane and Golgi apparatus of MDCK cells.
Hum Mol Genet 11
: 59
–67, 2002[Abstract/Free Full Text]
Gonzalez-Perrett S, Kim K, Ibarra C, Damiano AE, Zotta E, Batelli M, Harris PC, Reisin IL, Arnaout MA, Cantiello HF: Polycystin-2, the protein mutated in autosomal dominant polycystic kidney disease (ADPKD), is a Ca2+-permeable nonselective cation channel.
Proc Natl Acad Sci U S A 98
: 1182
–1187, 2001[Abstract/Free Full Text]
Barr MM, DeModena J, Braun D, Nguyen CQ, Hall DH, Sternberg PW: The
Caenorhabditis elegans autosomal dominant polycystic kidney disease gene homologs lov- 1 and pkd-2 act in the same pathway. Curr Biol 11
: 1341
–1346, 2001
Watnick TJ, Jin Y, Matunis E, Kernan MJ, Montell C: A flagellar polycystin-2 homolog required for male fertility in
Drosophila. Curr Biol 13
: 2179
–2184, 2003
Gao Z, Joseph E, Ruden DM, Lu X:
Drosophila Pkd2 is haploid-insufficient for mediating optimal smooth muscle contractility. J Biol Chem 279
: 14225
–14231, 2004
Kierszenbaum AL: Polycystins: What polycystic kidney disease tells us about sperm.
Mol Reprod Dev 67
: 385
–388, 2004[CrossRef][Medline]
Pennekamp P, Karcher C, Fischer A, Schweickert A, Skryabin B, Horst J, Blum M, Dworniczak B: The ion channel polycystin-2 is required for left-right axis determination in mice.
Curr Biol 12
: 938
–943, 2002[CrossRef][Medline]
Wu G, Markowitz GS, Li L, D’Agati VD, Factor SM, Geng L, Tibara S, Tuchman J, Cai Y, Park JH, van Adelsberg J, Hou H, Kucherlapati R, Edelmann W, Somlo S: Cardiac defects and renal failure in mice with targeted mutations in Pkd2.
Nat Genet 24
: 75
–78, 2000[CrossRef][Medline]
Qian Q, Li M, Cai Y, Ward CJ, Somlo S, Harris PC, Torres VE: Analysis of the polycystins in aortic vascular smooth muscle cells.
J Am Soc Nephrol 14
: 2280
–2287, 2003[Abstract/Free Full Text]
Torres VE, Cai Y, Chen X, Wu GQ, Geng L, Cleghorn KA, Johnson CM, Somlo S: Vascular expression of polycystin-2.
J Am Soc Nephrol 12
: 1
–9, 2001[Abstract/Free Full Text]
Yoder BK, Hou X, Guay-Woodford LM: The polycystic kidney disease proteins, polycystin-1, polycystin-2, polaris, and cystin, are co-localized in renal cilia.
J Am Soc Nephrol 13
: 2508
–2516, 2002[Abstract/Free Full Text]
Praetorius HA, Spring KR: Bending the MDCK cell primary cilium increases intracellular calcium.
J Membr Biol 184
: 71
–79, 2001[CrossRef][Medline]
Andrade YN, Fernandes J, Vazquez E, Fernandez-Fernandez JM, Arniges M, Sanchez TM, Villalon M, Valverde MA: TRPV4 channel is involved in the coupling of fluid viscosity changes to epithelial ciliary activity.
J Cell Biol 168
: 869
–874, 2005[Abstract/Free Full Text]
McGrath J, Somlo S, Makova S, Tian X, Brueckner M: Two populations of node monocilia initiate left-right asymmetry in the mouse.
Cell 114
: 61
–73, 2003[CrossRef][Medline]
Teilmann SC, Byskov AG, Pedersen PA, Wheatley DN, Pazour GJ, Christensen ST: Localization of transient receptor potential ion channels in primary and motile cilia of the female murine reproductive organs.
Mol Reprod Dev 71
: 444
–452, 2005[CrossRef][Medline]
Kottgen M, Benzing T, Simmen T, Tauber R, Buchholz B, Feliciangeli S, Huber TB, Schermer B, Kramer-Zucker A, Hopker K, Simmen KC, Tschucke CC, Sandford R, Kim E, Thomas G, Walz G: Trafficking of TRPP2 by PACS proteins represents a novel mechanism of ion channel regulation.
EMBO J 24
: 705
–716, 2005[CrossRef][Medline]
Wan L, Molloy SS, Thomas L, Liu G, Xiang Y, Rybak SL, Thomas G: PACS-1 defines a novel gene family of cytosolic sorting proteins required for trans-Golgi network localization.
Cell 94
: 205
–216, 1998[CrossRef][Medline]
Sun Z, Amsterdam A, Pazour GJ, Cole DG, Miller MS, Hopkins N: A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney.
Development 131
: 4085
–4093, 2004[Abstract/Free Full Text]
Bisgrove BW, Snarr BS, Emrazian A, Yost HJ: Polaris and polycystin-2 in dorsal forerunner cells and Kupffer’s vesicle are required for specification of the zebrafish left-right axis.
Dev Biol 287
: 274
–288, 2005[Medline]
Westerfield M:
The Zebrafish Book, Eugene, University of Oregon Press, 1995
Drummond IA, Majumdar A, Hentschel H, Elger M, Solnica-Krezel L, Schier AF, Neuhauss SC, Stemple DL, Zwartkruis F, Rangini Z, Driever W, Fishman MC: Early development of the zebrafish pronephros and analysis of mutations affecting pronephric function.
Development 125
: 4655
–4667, 1998[Abstract]
Venglarik CJ, Gao Z, Lu X: Evolutionary conservation of Drosophila polycystin-2 as a calcium-activated cation channel.
J Am Soc Nephrol 15
: 1168
–1177, 2004[Abstract/Free Full Text]
Pazour GJ, San Agustin JT, Follit JA, Rosenbaum JL, Witman GB: Polycystin-2 localizes to kidney cilia and the ciliary level is elevated in orpk mice with polycystic kidney disease.
Curr Biol 12
: R378
–R380, 2002[CrossRef][Medline]
Qian F, Germino FJ, Cai Y, Zhang X, Somlo S, Germino GG: PKD1 interacts with PKD2 through a probable coiled-coil domain.
Nat Genet 16
: 179
–183, 1997[CrossRef][Medline]
Tsiokas L, Kim E, Arnould T, Sukhatme VP, Walz G: Homo- and heterodimeric interactions between the gene products of PKD1 and PKD2.
Proc Natl Acad Sci U S A 94
: 6965
–6970, 1997[Abstract/Free Full Text]
Yamaguchi T, Wallace DP, Magenheimer BS, Hempson SJ, Grantham JJ, Calvet JP: Calcium restriction allows cAMP activation of the B-Raf/ERK pathway, switching cells to a cAMP-dependent growth-stimulated phenotype.
J Biol Chem 279
: 40419
–40430, 2004[Abstract/Free Full Text]
Kramer-Zucker AG, Olale F, Haycraft CJ, Yoder BK, Schier AF, Drummond IA: Cilia-driven fluid flow in the zebrafish pronephros, brain and Kupffer’s vesicle is required for normal organogenesis.
Development 132
: 1907
–1921, 2005[Abstract/Free Full Text]
Siroky BJ, Ferguson WB, Fuson AL, Xie Y, Fintha A, Komlosi P, Yoder BK, Schwiebert EM, Guay-Woodford LM, Bell PD: Loss of primary cilia results in deregulated and unabated apical calcium entry in ARPKD collecting duct cells.
Am J Physiol Renal Physiol 290
: F1320
–F1328, 2006[Abstract/Free Full Text]
Geng L, Okuhara D, Yu Z, Tian X, Cai Y, Shibazaki S, Somlo S: Polycystin-2 traffics to cilia independently of polycystin-1 by using an N-terminal RVxP motif.
J Cell Sci 119
: 1383
–1395, 2006[Abstract/Free Full Text]
Streets AJ, Moon DJ, Kane ME, Obara T, Ong AC: Identification of an N-terminal glycogen synthase kinase 3 phosphorylation site which regulates the functional localisation of polycystin-2 in vivo and in vitro.
Hum Mol Genet 15
: 1465
–1473, 2006[Abstract/Free Full Text]
Chen XZ, Segal Y, Basora N, Guo L, Peng JB, Babakhanlou H, Vassilev PM, Brown EM, Hediger MA, Zhou J: Transport function of the naturally occurring pathogenic polycystin-2 mutant, R742X.
Biochem Biophys Res Commun 282
: 1251
–1256, 2001[CrossRef][Medline]
Sayer JA, Otto EA, O’Toole J, F, Nurnberg G, Kennedy MA, Becker C, Hennies HC, Helou J, Attanasio M, Fausett BV, Utsch B, Khanna H, Liu Y, Drummond I, Kawakami I, Kusakabe T, Tsuda M, Ma L, Lee H, Larson RG, Allen SJ, Wilkinson CJ, Nigg EA, Shou C, Lillo C, Williams DS, Hoppe B, Kemper MJ, Neuhaus T, Parisi MA, Glass IA, Petry M, Kispert A, Gloy J, Ganner A, Walz G, Zhu X, Goldman D, Nurnberg P, Swaroop A, Leroux MR, Hildebrandt F: The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4.
Nat Genet 38
: 674
–681, 2006[CrossRef][Medline]
Potter EL:
Normal and Abnormal Development of the Kidney, Chicago, Year Book Medical Publishers, 1972
Woolf AS, Price KL, Scambler PJ, Winyard PJ: Evolving concepts in human renal dysplasia.
J Am Soc Nephrol 15
: 998
–1007, 2004[Abstract/Free Full Text]
Arnaout MA: Molecular genetics and pathogenesis of autosomal dominant polysyctic kidney disease.
Annu Rev Med 52
: 93
–123, 2001[CrossRef][Medline]
Tanner GA, Gretz N, Connors BA, Evan AP, Steinhausen M: Role of obstruction in autosomal dominant polycystic kidney disease in rats.
Kidney Int 50
: 873
–886, 1996[Medline]
Myat MM, Andrew DJ: Epithelial tube morphology is determined by the polarized growth and delivery of apical membrane.
Cell 111
: 879
–891, 2002[CrossRef][Medline]
Gallagher AR, Cedzich A, Gretz N, Somlo S, Witzgall R: The polycystic kidney disease protein PKD2 interacts with Hax-1, a protein associated with the actin cytoskeleton.
Proc Natl Acad Sci U S A 97
: 4017
–4022, 2000[Abstract/Free Full Text]
Lehtonen S, Ora A, Olkkonen VM, Geng L, Zerial M, Somlo S, Lehtonen E: In vivo interaction of the adapter protein CD2-associated protein with the type 2 polycystic kidney disease protein, polycystin-2.
J Biol Chem 275
: 32888
–32893, 2000[Abstract/Free Full Text]
Li Q, Dai Y, Guo L, Liu Y, Hao C, Wu G, Basora N, Michalak M, Chen XZ: Polycystin-2 associates with tropomyosin-1, an actin microfilament component.
J Mol Biol 325
: 949
–962, 2003[CrossRef][Medline]
Li Q, Shen PY, Wu G, Chen XZ: Polycystin-2 interacts with troponin I, an angiogenesis inhibitor.
Biochemistry 42
: 450
–457, 2003[CrossRef][Medline]
Rundle DR, Gorbsky G, Tsiokas L: PKD2 interacts and co-localizes with mDia1 to mitotic spindles of dividing cells: Role of mDia1 IN PKD2 localization to mitotic spindles.
J Biol Chem 279
: 29728
–29739, 2004[Abstract/Free Full Text]
Wiederhold ML: Mechanosensory transduction in "sensory" and "motile" cilia.
Annu Rev Biophys Bioeng 5
: 39
–62, 1976[CrossRef][Medline]
Stommel EW, Stephens RE, Alkon DL: Motile statocyst cilia transmit rather than directly transduce mechanical stimuli.
J Cell Biol 87
: 652
–662, 1980[Abstract/Free Full Text]
Related Article
This Month’s Highlights
J. Am. Soc. Nephrol. 2006 17: 2635-2636.
[Full Text][PDF]
This article has been cited by other articles:
S. Feng, G. M. Okenka, C.-X. Bai, A. J. Streets, L. J. Newby, B. T. DeChant, L. Tsiokas, T. Obara, and A. C. M. Ong Identification and Functional Characterization of an N-terminal Oligomerization Domain for Polycystin-2
J. Biol. Chem.,
October 17, 2008;
283(42):
28471 - 28479.
[Abstract][Full Text][PDF]
A. Garic-Stankovic, M. Hernandez, G. R. Flentke, M. H. Zile, and S. M. Smith A ryanodine receptor-dependent Cai2+ asymmetry at Hensen's node mediates avian lateral identity
Development,
October 1, 2008;
135(19):
3271 - 3280.
[Abstract][Full Text][PDF]
M. Kottgen, B. Buchholz, M. A. Garcia-Gonzalez, F. Kotsis, X. Fu, M. Doerken, C. Boehlke, D. Steffl, R. Tauber, T. Wegierski, et al. TRPP2 and TRPV4 form a polymodal sensory channel complex
J. Cell Biol.,
August 11, 2008;
182(3):
437 - 447.
[Abstract][Full Text][PDF]
X. Fu, Y. Wang, N. Schetle, H. Gao, M. Putz, G. von Gersdorff, G. Walz, and A. G. Kramer-Zucker The Subcellular Localization of TRPP2 Modulates Its Function
J. Am. Soc. Nephrol.,
July 1, 2008;
19(7):
1342 - 1351.
[Abstract][Full Text][PDF]
I. A. Drummond Some Assembly Required: Renal Hypodysplasia and the Problem with Faulty Parts
J. Am. Soc. Nephrol.,
May 1, 2008;
19(5):
834 - 836.
<
Top
Abstract
Introduction
6F [Developmental Studies Hybridoma Bank, University of Iowa], acetylated tubulin mAb 13-6-11B, and anti-zebrafish Polycystin-2) or by 4% paraformaldehyde/PBS fixation (96535 anti-mammalian Polycystin-2). Embryos were blocked in 10% normal goat serum and incubated in primary antibody in 1% DMSO/2% normal goat serum/0.1% Tween-20/PBS overnight at 4°C. After washing in incubation medium, secondary antibodies (Alexa 548, Alexa 488; Molecular Probes, Eugene, OR) were used at 1:1000. Washed embryos were cleared in benzyl benzoate:benzyl alcohol and photographed on a Nikon800 fluorescence microscope or on a BioRad Radiance6000 confocal fluorescence microscope. For sections, stained embryos were dehydrated and embedded in JB-4 resin (Polyscience Inc., Warrington, PA) following the manufacturer’s instructions and cut at 1 to 4 µm. 
-actin was performed as a positive control. For MOex3, pkd2ex3F1 TCGTCTTTTGGGTGAGAGCAACA, pkd2ex3R1, CGAATGGTGCCTTGTCCTCATTG, and pkd2ex3F2 TCCTCTTCCTGCTCACCCTCTGC, pkd2ex3R2 TCGTCTCGCAGATCCTCATGGAC. For MOex5, pkd2ex5F1 GGCCCGTTTCTTAACGGCATGTA, pkd2ex5R1 CTCTTGAAGTAGCGCAGCCGATG, pkd2ex5F2 GGCCCGTTTCTTAACGGCATGTA, and pkd2ex5R2, CTGGAGACATAGCGGAGCAGACG. For MOex12 and MOex13, pkd2ex9F1 GCACCTTTCAGGCCTGCATTTTC, pkd2ex14R1 GGAGTGGCCTGATGATGATGGTG, pkd2ex9F2 CACGCAGTTCCGGATCATACTGG, and pkd2ex14R2 CCAGCTCGTCCCTAACCAACCTG. 
