 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cell Biology |
1 Actions and the 12/15-Lipoxygenase Pathway in Mesangial Cells
* Gonda Diabetes Research Center, Beckman Research Institute of the City of Hope, Duarte, California; Division of Nephrology, Dorrance Hamilton Research Laboratories, Department of Medicine, Thomas Jefferson University, Philadelphia, Pennsylvania; and Division of Nephrology and Hypertension, Department of Internal Medicine, Harbor-UCLA Research and Education Institute, Torrance, California
Address correspondence to: Dr. Rama Natarajan, Gonda Diabetes Research Center, Beckman Research Institute of the City of Hope, 1500 East Duarte Road, Duarte, CA 91010. Phone: 626-359-8111, ext 62289; Fax: 626-301-8136; rnatarajan{at}coh.org
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
is a major player in the pathogenesis of DN, whether there is an interplay between the TGF- and 12/15-LO pathways in MC was evaluated. Treatment of rat MC (RMC) with TGF- significantly increased levels of the 12/15-LO product 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] and also 12/15-LO mRNA and protein expression. HG-induced TGF- mRNA expression in RMC was inhibited by a specific ribozyme and siRNA targeted to knockdown rat 12/15-LO. It is interesting that direct treatment of RMC with 12(S)-HETE increased TGF- mRNA and protein levels, as well as p-Smad2/3, which are TGF-–specific target transcription factors. 12(S)-HETE also increased transcription from a minimal TGF- promoter. Furthermore, TGF- expression and p-Smad2/3 levels were lower in MC from 12/15-LO knockout mice relative to control mice. Reciprocally, mouse MC stably overexpressing 12/15-LO had greater TGF- mRNA and also nuclear p-Smad2/3 relative to mock-transfected cells. 12/15-LO and TGF- could functionally signal and increase ECM expression via the p38 mitogen-activated protein kinase signaling pathway. These results indicate for the first time that the 12/15-LO and TGF- pathways can cross-talk and activate each other. These novel interactions may amplify the signal transduction cascades and molecular events that lead to DN. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 is a key mediator in the pathogenesis of progressive renal diseases such as diabetic nephropathy (DN) (1,2). Multifunctional cytokines of the TGF- family can regulate cell growth, differentiation, development, extracellular matrix (ECM) production, and apoptosis (3). TGF-1, 2, and 3 are expressed in mammals. TGF-1 is typically associated with fibrosis in the kidney and other organs (3–5). TGF-2 and TGF-3 have also been shown to have fibrotic effects in renal cells, although their effects were partially mediated by TGF-1 (5).
Factors that are relevant to the pathogenesis of DN, such as high glucose (HG) and advanced glycation end products (AGE), can increase TGF-1 expression in glomerular mesangial cells (MC) and endothelial cells (6–8). Increased renal production of TGF- has been observed in patients with diabetes and also in diabetic animal models (1,2,9). TGF- has several effects in renal cells, including the stimulation of production of types I and IV collagen, laminin, heparin sulfate proteoglycan, and fibronectin (FN) (1,2,10–12). TGF- also inhibits plasminogen activator-1 production (13) while increasing matrix metalloproteinase-2 (12). In vivo evidence of the pathologic role played by TGF- in diabetic kidney disease was demonstrated by the improvement in glomerular filtration rates induced by an anti–TGF- antibody in experimental DN (14), although, interestingly, proteinuria did not improve.
When TGF- interacts with its receptors, it induces the phosphorylation and nuclear translocation of the receptor-regulated Smad2 and Smad3 transcription factors (4,15,16). These phosphorylated Smad2 and Smad3 proteins then can associate with Smad4 (common Smad), and this complex translocates to the nucleus, leading to gene regulation. MC express Smad2/3, Smad4, and Smad7 (inhibitory Smad), which mediate TGF-–induced gene expression, including that of ECM genes such as plasminogen activator-1 and type I collagen (11,13,17–19). There is also evidence that, apart from the Smad pathway, the matrix-inducing actions of TGF- may also be mediated via activation of mitogen-activated protein kinases (MAPK) (20). Overall, TGF- is a well-established pathologic and profibrotic agent in the kidney. However, although dyslipidemia is associated with renal disease, very little is known regarding the role of lipids in mediating TGF- actions or its expression.
Lipoxygenases (LO) are a family of nonheme iron-containing enzymes that insert molecular oxygen into polyunsaturated fatty acids such as arachidonic and linoleic acids (21,22). They are classified as 5-, 8-, 12-, and 15-LO on the basis of the carbon atom of arachidonic acid at which oxygen is inserted (21,22). 12-LO activation can lead to the formation of oxidized lipids such as 12(S)-hydroxyeicosatetraenoic acid [12(S)-HETE] (21). Human and rabbit 15-LO as well as the leukocyte-type 12-LO have high homology and are classified as 12/15-LO (especially in rat and mouse) because they can form both 12(S)-HETE and 15(S)-HETE from arachidonic acid (21,22). Recently, there has been heightened interest in 12/15-LO pathway because of key data implicating it in the pathogenesis of atherosclerosis, restenosis, and hypertension (23–25).
Increased urinary 12(S)-HETE excretion was noted in patients with diabetes, suggesting a renal origin (26). 12/15-LO is present in the kidney (27,28), and recent data indicate its potential significance and function. Thus, 12/15-LO mRNA and protein are increased in glucose-stimulated MC and in experimental DN (27). Furthermore, in vivo expression of the matrix protein FN and TGF- in diabetic rat glomeruli were associated with increased glomerular 12/15-LO expression (27), thereby implicating the 12/15-LO pathway in the pathogenesis of DN. Factors that are relevant to the pathogenesis of DN, such as HG, angiotensin II (Ang II), and PDGF, increased leukocyte-type 12/15-LO activity and expression in rat MC (RMC) and vascular smooth muscle cells (VSMC) (27,29–31). The growth-promoting and matrix-inducing effects of Ang II in MC were blocked by pharmacologic 12-LO inhibitors as well as a novel 12-LO ribozyme (31). Furthermore, 12(S)-HETE could directly induce cellular hypertrophy and expression of the ECM protein FN in RMC with similar potency as Ang II (31). 12(S)-HETE–induced effects were mediated at least in part by p38 MAPK and its target transcription factor, cAMP response element binding protein (31,32).
We also recently demonstrated the potential in vivo functional role of 12/15-LO in MC growth related to glomerulosclerosis and nephropathy by comparing the properties of mouse MC (MMC) derived from 12/15-LO knockout (LOKO) mice with those obtained from genetic control wild-type mice (WT) (33). Cellular growth, matrix production, activation of oxidant stress, MAPK activation, and transcription factor cAMP response element binding protein activation were attenuated in LOKO cells relative to WT cells (33).
Although the presence and significance of 12/15-LO and profibrotic TGF- are now recognized in connection with glomerular matrix accumulation, the interrelationships between TGF- and 12/15-LO in MC or DN is not known. In this study, we examined for the first time the effect of TGF- on 12/15-LO activity and expression and also the reciprocal effects of the 12-LO product 12(S)-HETE on TGF- expression and phosphorylation of Smad2/3 in MC. We also examined the signaling pathways involved and functional consequences. Our results reveal a novel cross-regulation of these two pathways that could result in the amplification of the pathologic processes that lead to DN.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
antibody and normal rabbit IgG, recombinant human TGF-, and TGF- ELISA kits were from R&D systems (Minneapolis, MN); inhibitors of p38 MAPK (SB202190) and ERK1/2 pathway (PD98059) were from Calbiochem (La Jolla, CA); antibodies for phosphospecific and nonphospho-p38 MAPK and -ERK1/2 and horseradish peroxidase–conjugated secondary antibodies were from Cell Signaling (Beverly, MA); Supersignal chemiluminescence reagent was from Pierce (Rockford, IL); -actin antibody was from Sigma (St. Louis, MO); relative multiplex reverse transcriptase–PCR (RT-PCR) kits and primers for Quantum RNA 18S internal standards were from Ambion (Austin, TX); Lipofectamine 2000 transfection reagent was from Invitrogen (Carlsbad, CA); pEGFP-N1 was from Clontech (Palo Alto, CA); and RNA-STAT 60 reagent was from Tel-Test (Friendswood, TX).
Cell Culture
Primary cultures of RMC from Sprague-Dawley rats were obtained and cultured as described previously (27). Cells between 5 and 12 passages were used. An immortalized MMC cell line was cultured as described (33). Primary cultures of MMC from genetic control (C57BL/6, WT) and leukocyte-type 12/15-LOKO mice (Jackson Laboratories; strain B6.129S2-Alox15tm1Fun) were obtained as described (33) and according to a protocol approved by the Institutional Research Animal Care Committee.
12(S)-HETE Assay
Serum-depleted RMC were treated with recombinant human TGF- (10 ng/ml) for 30 min or 1 h. Culture dishes then were cooled, and the supernatants were aspirated and saved at –70°C. Cell pellets were lysed and deacetylated. 12(S)-HETE levels in cell extracts and supernatants were quantitated by a specific RIA as described previously (29,34).
RNA Isolation and RT-PCR
Isolation of total RNA and RT-PCR using gene-specific primes along with 18S RNA primers as internal standards were performed as described previously (31). The following gene-specific primers were used in the RT-PCR reactions: Rat 12/15-LO (290-bp product): sense 5'-GTC TAC TCC ACC ACC TAT TTT C-3') and antisense 5'-CTG TGC TCA TTG CCT TGT C-3'; mouse TGF-1(300-bp product): sense 5'-CAA CGC CAT CTA TGA GAA AAC C-3' and antisense 5'-AAG CCC TGT ATT CCG TCT CC-3'; rat TGF-1 (403-bp product): sense 5'-CGA GGT GAC CTG GGC ACC ATC C-3' and antisense 5'-CTG TGC TCA TTG CCT TGT C-3'; rat collagen 
1 (I) (413-bp product): sense 5'-GTG AAC CCG GCA AAC AAG GT-3' and antisense 5'-CTG GAG ACC AGA GAA GCC AC-3'; rat FN (446-bp product): sense 5'-GCA AGC CTG AAC CTG AAG AGA CC-3' and antisense 5'-CCT GGT GTC CTG ATC ATT GCA TC3'.
Western Blotting
Cells were lysed in Laemmli’s sample buffer, fractionated on 10% SDS-PAGE gels (Bio-Rad, Hercules, CA), and immunoblotted with antibodies to 12/15-LO (1:400) (30,33), phospho-p38 MAPK (1:1000), phospho-ERK1/2 (1:1000), or phospho-Smad2/3 (1:200) as described (31,32). The blots were stripped and then reprobed with an antibody to -actin (1:5000), total p38 MAPK (1:1000), total ERK1/2 (1:1000), or Smad2/3 (1:200). Immunoblots were scanned using GS-800 densitometer, and protein bands were quantified with Quantitation One software (Bio-Rad).
Immunofluorescence
Confluent MMC on glass slides were fixed with 2% paraformaldehyde in PBS for 15 min. Cells were permeabilized with 0.2% Triton-X100 in PBS and washed. For reducing nonspecific binding, cells were treated with 5% goat serum in PBS and then incubated with 1:40 p-Smad2/3 antibody, followed by incubation with rhodamine-conjugated secondary antibody (1:200) and viewed using a fluorescence microscope.
Transfection of Rat 12/15-LO Ribozyme
RMC were plated in 60-mm culture dishes and transfected the next day (80% confluent) with a chimeric DNA-RNA hammerhead ribozyme (Rz) targeted to cleave rat leukocyte-type 12/15-LO (Rz) or control catalytically inactive mutant 12/15-LO Rz (mRz) oligonucleotides using Lipofectamine 2000 as described (31). After 6 h, cells were washed and fresh medium that contained 1% FCS was added. The next day, cells were placed in serum-free RPMI 1640 medium that contained 0.2% BSA and 5.5 mM glucose (normal glucose) or 25 mM glucose (high glucose [HG]). Twenty-four hours later, total RNA was extracted and TGF- mRNA levels were determined by RT-PCR.
Construction of Rat Leukocyte Type 12/15-LO-Specific Short Hairpin RNA Vectors and Transfection
We also used RNA interference initiated by small interfering RNA (siRNA) to effectively suppress 12/15-LO gene expression. For more stable suppression of gene expression, we constructed Pol III U6 promoter-driven short hairpin RNA (shRNA) targeting rat leukocyte-type 12/15-LO using a modification of a protocol that uses a PCR-based strategy for rapid screening of siRNA accessibility sites (35,36). Briefly, the siRNA target sequences on rat 12/15-LO mRNA are GCAACTGGATTTCTGTGAAGG (m233) and GAAGCGGATTTCTTCCTTCTG (m826). We used a combination of shRNA to both of these sites because we obtained better gene suppression with two together than individually as also reported for other genes (35,36). The final PCR products included the U6 promoter, followed by 21nt sense siRNA sequence, 9nt hairpin, and 21nt antisense sequence. For PCR, the vector pTZU6 + 1 was used as template. The universal U6 forward primer was 5'-GGAAGATCTGGATCCAAGGTCGGGCAGG-5', and the reverse primers were 5'-CCAAGCTTCCCGGGAAAAAAGCAACTGGATTTCTGTGAAGGCTACACAAACCTTCACAGAAATCCAGTTGCGGTGTTTCGTCCTTTCC-3' (for m233) and 5'-CCAAGCTTCCCGGGAAAAAAGAAGCGGATTTCTTCCTTCTGCTACACAAACAGAAGGAAGAAATCCGCTTCGGTGTTTCGTCCTTTCC-3' (for m826). These PCR products were inserted into pCR3.1 vector to generate the shRNA (pCR3.1-m233 or -m826 siRNA) first and then an EGFP fragment was inserted into these pCR3.1-shRNA vectors to track transfection efficiency and facilitate cell sorting. This was done by first digesting the vector pEGFP-N1 at AseI and Afl II sites followed by ligation of the CMV promoter and EGFP fragments to Hinc II and SacI sites of pCR3.1-shRNA to generate the pCR3.1/EGFP shRNA vectors. We also used GGATATATCCCGAACTAGACA sequence to make a control scrambled shRNA unrelated to any gene. The empty vector has everything except siRNA. RMC were transfected with the shRNA using Lipofectamine 2000 reagent. Forty-eight hours after transfection, the cells were selected with 400 µg/ml G418 for 1 wk.
Transient Transfection and Reporter Gene Assays
Immortalized MMC were plated in 12-well plates and transfected the next day with 1 µg/well TGF-1-Luc promoter construct (pA835) (6) using Lipofectamine 2000. Cells then were allowed to recover overnight in serum that contained medium and then transferred to serum-free medium that contained 0.2% BSA. The next day, they were stimulated with 12(S)-HETE (0.1 µM). Cells then were lysed, and luciferase activities were assayed as described (32,33).
ELISA
Cell supernatants were frozen at –20°C until assay by a sandwich TGF- ELISA kit according to the manufacturer’s specifications. Acid activation of supernatants of MMC was first performed to convert latent TGF- into active TGF- form that can be recognized by the antibody. Total (latent + active) TGF- in a sample was compared with known standards and read as ng/ml.
Statistical Analyses
Data are expressed as mean ± SEM of multiple experiments. Paired t tests were used to compare two groups, or ANOVA with Dunnet’s post test for multiple groups using PRISM software (Graph Pad, San Diego, CA). Statistical significance was detected at the 0.05 level.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Induces 12/15-LO mRNA and Protein Expression in RMC for 0 to 24 h, and 12/15-LO mRNA expression was determined by RT-PCR. Figure 1A shows that TGF- (10 ng/ml) treatment can induce 12/15-LO mRNA expression in RMC by 6 h, and this remains sustained for 24 h. 12/15-LO transcript levels were quantified as the ratio of density of 12/15-LO to 18S band and depicted by the bar graph in Figure 1B. To determine whether this increase in 12/15-LO mRNA was associated with an increase in 12/15-LO protein expression, we performed immunoblotting using 12/15-LO antibody. Figure 1C shows that TGF- treatment for 8 h increased 12/15-LO protein levels in RMC even at 1 ng/ml.
|
Increases Levels of the 12/15-LO Product 12(S)-HETE in RMC alters 12/15-LO activity by examining levels of cell-associated and released 12/15-LO product, 12(S)-HETE by a RIA specific to 12(S)-HETE (29). Figure 2 shows that TGF- treatment significantly increased the levels of cell-associated 12(S)-HETE and released 12(S)-HETE in cell supernatants, respectively, in RMC at 30 min as well as 1 h. Thus, TGF- increases 12/15-LO activity by 30 min to 1 h, whereas protein and mRNA expression are increased by 6 h.
|
mRNA Expression in RMC expression. We therefore treated RMC with 12(S)-HETE for time periods ranging from 1 to 24 h and examined rat TGF- mRNA expression by RT-PCR. Figure 3A shows that 12(S)-HETE can increase TGF- mRNA expression by 2 h, and this remains sustained for 24 h. Bar graph quantification is seen in Figure 3B. We also confirmed that this effect of 12(S)-HETE was specific because a stereoisomer, 12(R)-HETE, which is not a LO product, did not increase TGF- mRNA expression (Figure 3C).
|
1 Promoter in MMC mRNA levels, we next examined whether 12(S)-HETE could also increase the transcriptional activity of the TGF- promoter. MMC were transiently transfected with a plasmid pA835, which contains the luciferase gene under the control of a minimal TGF- promoter (6) and were left untreated or stimulated with 12(S)-HETE or HG for 18 h. Figure 4 shows that 12(S)-HETE could induce the transcriptional activity of TGF- promoter as demonstrated by significant increase in luciferase activity. HG also increased the transcriptional activity as expected. Furthermore, the effects of HG and 12(S)-HETE together were also synergistic indicating a potential cross-talk between the HG and 12(S)-HETE activated pathways leading to TGF- transcription.
|
mRNA Expression by a 12/15-LO Ribozyme or 12/15-LO shRNA in RMC (14,37,38). We therefore hypothesized that HG-induced TGF- may be mediated at least in part by 12/15-LO activation. To test this, we used a novel short hammerhead Rz as a molecular tool to cleave and inactivate rat 12/15-LO (31). Control for the Rz was an mRz with a point mutation at the catalytic site. RMC were transfected with the Rz or the mRz and then treated with HG (25 mM) for 24 h. Results shown in Figure 5A indicate that the 12/15-LO Rz could clearly reduce HG-induced rat TGF- mRNA expression by >50%. The control mRz, however, had no effect.
|
mRNA in RMC. These new results suggest that HG-induced TGF- expression is mediated, at least in part, by the 12/15-LO pathway.
12(S)-HETE Treatment Increases Smad2/3 Phosphorylation in RMC
Because 12(S)-HETE could increase TGF- expression, we anticipated that it should also increase the activity of Smad2/3, which are TGF--specific transcription factors. RMC were treated with 12(S)-HETE for various time periods, and Smad2/3 phosphorylation was evaluated by immunoblotting with an antibody that recognizes p-Smad2 and 3. 12(S)-HETE (0.1 µM) could increase p-Smad2/3 levels in a time-dependent manner, peaking at 6 h and declining by 24 h (Figure 6A, top). No change in total Smad2/3 was seen under these conditions (Figure 6A, bottom). The ratio of pSmad2/3 and total Smad2/3 in control samples and cells stimulated with 12(S)-HETE for 6 h is shown in Figure 6B.
|
mRNA Expression and Smad2/3 Activity Are Elevated in an MMC Cell Line Stably Overexpressing 12/15-LO expression and Smad2/3 activity in MC, we hypothesized that these parameters must be elevated in MC that overexpress 12/15-LO. We stably overexpressed mouse 12/15-LO cDNA in an immortalized MMC line that retains MC characteristics (31,33). We compared levels of TGF- mRNA and p-Smad2/3 in these cells versus control pcDNA3.1 vector (mock transfected). As shown in Figure 7, A and B, the 12/15-LO-overexpressing cells had greater levels of mouse TGF- mRNA expression relative to mock-transfected pcDNA cells. 18S RNA levels were similar in both cells. In addition, as shown in Figure 7, C and D, the 12/15-LO-overexpressing cells had significantly greater levels of p-Smad2/3 relative to mock-transfected pcDNA cells. Furthermore, immunofluorescent staining with anti-p-Smad2/3 demonstrates higher levels of nuclear p-Smad2/3 in 12/15-LO-overexpressing cells relative to pcDNA (Figure 7E). These results are consistent with our hypothesis that 12/15-LO products increase TGF- as well as phosphorylation of downstream effector Smad transcription factors associated with TGF- signaling.
|
and Phospho-Smad2/3 Levels in MMC Derived from WT versus 12/15-LOKO Mice expression and MMC overexpressing 12/15-LO had elevated TGF- levels, we next hypothesized that MMC derived from LOKO mice would have lower levels of TGF- than those from control WT mice. MMC from WT and LOKO mice were serum-depleted for 48 h and then treated with or without FCS (10%) for 24 h. Supernatants were saved for measurement of TGF- protein levels by ELISA, whereas cells were used to determine TGF- mRNA or phospho-Smad levels. Figure 8A shows that basal and FCS-stimulated expression levels of TGF- protein were markedly lower in MMC derived from LOKO mice relative to WT. Furthermore, Figure 8B shows that TGF- mRNA levels were also lower in MMC derived from LOKO mice. Figure 8, C and D, shows that p-Smad2/3 levels were also significantly lower in MMC derived from LOKO mice. Overall, these results are supportive of 12/15-LO playing a key role in TGF- expression and activation of its downstream effector Smad2/3, and vice versa, thus demonstrating a cross-talk in MC.
|
Effects in RMC exert their effects and potentially mediate a cross-talk. We therefore examined the activation of key growth- and stress-related MAPK. Serum-depleted RMC were treated with 12(S)-HETE (0.1 µM) or TGF- (10 ng/ml) for various time periods, and MAPK activation was determined by Western blotting with phosphospecific antibodies that recognize only the activated kinases. As shown in Figure 9A, a marked increase in p38 MAPK activation could be seen within 1 h after stimulation with 12(S)-HETE and remained elevated until 24 h. However, 12(S)-HETE did not significantly activate ERK1/2. These results demonstrate that 12(S)-HETE is a potent activator of p38 MAPK but not ERK1/2 in RMC. As shown in Figure 9B, TGF- in turn could increase both p38 MAPK and ERK1/2 activation from 1 to 6 h.
|
mRNA expression, we posed the question of whether the p38 MAPK pathway was involved in mediating 12(S)-HETE-induced TGF- mRNA expression. Serum-depleted RMC were pretreated with the p38 MAPK inhibitor SB202190 (10–6 M) for 30 min and then stimulated with 12(S)-HETE for 24 h. SB202190 significantly inhibited the activation of p38 MAPK by 12(S)-HETE (data not shown). In the presence of SB202190, 12(S)-HETE-induced increase in TGF- mRNA was clearly attenuated (Figure 10A, top). Furthermore, we examined whether MAPK activation plays a functional role in ECM accumulation by 12(S)-HETE. We observed that 12(S)-HETE increased mRNA expression of the ECM proteins collagen 1 (I) and FN, and these were blocked by the p38 MAPK inhibitor (Figure 10A, middle and bottom).
|
–induced 12/15-LO expression. In the presence of SB202190 (10–6 M) or the ERK pathway inhibitor PD98059 (10–6 M), TGF-–induced 12/15-LO mRNA expression was markedly attenuated (Figure 10B, top). Furthermore, TGF-–induced collagen 1(I) and FN mRNA expression were inhibited by both SB202190 and PD98059 (Figure 10B, middle and bottom). SB202190 or PD98059 alone had no effect. These results support the operation of a p38 MAPK-dependent cross-talk between the two pathways.
Inhibition of 12(S)-HETE Induced Collagen 1(I) and FN mRNA Expression by Neutralization with a TGF- Antibody, and Inhibition of TGF- Induced Collagen 1(I) and FN mRNA Expression by 12/15-LO shRNA
We next examined whether 12(S)-HETE–induced collagen 1(I) and FN expression can be blocked by neutralization with a TGF- antibody in RMC. RMC were serum-depleted for 48 h and then stimulated with 12(S)-HETE for 24 h after 1 h of preincubation with pan-specific TGF- antibody (25 µg/ml) or control IgG. Figure 11A shows that in 12(S)-HETE–treated cells, collagen 1(I) and FN mRNA expression were increased by 24 h, and this was clearly attenuated by pretreatment with the TGF- antibody but not control IgG. These results suggest that 12(S)-HETE can induce collagen 1(I) and FN mRNA expression in RMC through TGF- signaling. The former may be mediated by Smad, whereas MAPK may be involved in the latter (13,17). Furthermore, Figure 11B shows that in TGF-–treated cells, collagen 1(I) and FN mRNA expression were increased by 24 h, and this was clearly attenuated by pretreatment with the 12/15-LO shRNA but not control scrambled shRNA (Scr). These results suggest that TGF- can induce collagen 1(I) and FN mRNA expression in RMC at least in part through the 12/15-LO pathway.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
plays a pivotal role in cellular growth and ECM production, and many of its actions in renal cells resemble those of high ambient glucose in the kidney. We recently demonstrated that the 12/15-LO pathway of arachidonate metabolism was enhanced in experimental DN in rats and correlated with expression of the ECM protein FN (27). 12/15-LO expression and products were also increased in HG-stimulated MC (27). Furthermore, LO products such as 12(S)-HETE could directly increase cellular hypertrophy and FN production in RMC (31). Thus, both 12/15-LO pathway products and TGF- can mediate cellular growth, ECM production, and HG effects in MC. The present study provides the first evidence of an interaction and cross-talk between the actions of oxidized lipids of the 12/15-LO pathway and TGF- in MC resulting in a potential feedback/feedforward amplifying loop in glomerulosclerosis.
We observed for the first time that TGF- can increase the formation of the LO product 12(S)-HETE and also augment 12/15-LO protein and mRNA expression in MC and thus directly activate the 12/15-LO pathway. Evidence shows that other growth factors, such as Ang II and PDGF, can induce 12/15-LO expression and activity in MC and VSMC (29–32). Furthermore, Ang II–induced effects in MC such as hypertrophy and FN expression were mediated, at least in part, by 12/15-LO activation (31). These data indicate that oxidized bioactive lipids such as those generated by the 12/15-LO pathway may mediate the effects of TGF- as well as other growth factors and thereby play a key role in the pathogenesis of DN.
We observed that the 12-LO product 12(S)-HETE can increase the protein and mRNA expression of TGF- and also induce TGF- promoter transcriptional activity. Furthermore, 12(S)-HETE increased phosphorylation of Smad2/3. This coincided temporally with the time that TGF- expression was induced by 12(S)-HETE. The effects of 12(S)-HETE were specific because an isomer, 12(R)-HETE, which is not a LO product, did not alter TGF- expression. 12(S)-HETE–induced increase in the transcriptional activity of TGF-1 was comparable to the effects of HG; furthermore their effects were synergistic, suggesting that HG and 12(S)-HETE may operate through some similar as well as synergistic pathways. The specific molecular mechanisms and promoter elements involved in 12(S)-HETE–induced TGF- expression are not yet clear and will be the focus of future studies.
Further evidence of TGF- regulation by 12/15-LO was obtained by data showing that MMC overexpressing mouse 12/15-LO had increased levels of TGF- mRNA as well as p-Smad2/3 compared with mock-transfected cells. These LO-overexpressing MMC also had elevated levels of FN mRNA (33). Reciprocally, MMC derived from LOKO mice had reduced levels of TGF- relative to those from WT mice. This is supported by our recent data showing that MMC from these LOKO mice produced significantly lower levels of 12(S)-HETE and also markedly decreased FN expression (33). Overall, these results suggest that 12/15-LO pathway may contribute to renal dysfunction via activation of the TGF- signaling pathway.
In this study, we showed for the first time that 12(S)-HETE can also induce the expression of another key TGF-–regulated ECM protein, namely 1 chain of type 1 collagen [collagen 1(I)] that is a downstream target gene of Smad. It is interesting that 12(S)-HETE–induced collagen 1(I) and FN expression were blocked by a TGF-–neutralizing antibody. We then examined whether the effect of TGF- on collagen 1(I) and FN expression can be attenuated in 12/15-LO shRNA transfected RMC. The recently developed technique of RNA interference (RNAi) mediated by siRNA and shRNA is powerful because it can investigate specific functions of a target gene that cannot be studied easily with knockout mouse models (39–41). We noted that TGF-–induced collagen 1(I) and FN expression were attenuated by the 12/15-LO shRNA in MC compared with scrambled shRNA transfected cells. These results indicate the operation of a loop mechanism wherein 12(S)-HETE can stimulate collagen 1(I) and FN mRNA expression through activation of TGF- signaling, whereas TGF- can stimulate collagen 1(I) and FN mRNA expression through 12/15-LO pathway. The former may be mediated by Smad, whereas MAPK maybe involved in the latter because evidence shows that collagen is a key target of Smad whereas TGF-–induced FN is Smad independent (13,17). This cross-talk can further amplify ECM protein expression.
To evaluate the interactive signaling mechanisms involved, we examined the effect of 12(S)-HETE and TGF- on MAPK activation. Our recent data implicated p38 but not ERK1/2 MAPK activation in 12(S)-HETE–induced FN expression in MC (31). Because TGF- and HG can also activate p38 MAPK in MC (42,43), we reasoned that p38 MAPK activation may be a key focal point of integration of signals from 12(S)-HETE, TGF-, and possibly HG. In this study, we observed that 12(S)-HETE could directly activate p38 MAPK but not ERK1/2, whereas TGF- could stimulate both p38 MAPK and ERK1/2 activation as reported earlier (17,43,44). Moreover, a specific chemical inhibitor of p38 MAPK, SB202190, blocked 12(S)-HETE–induced TGF-, collagen 1(I), and FN expression. The ERK1/2 pathway–specific inhibitor PD98059 and p38 MAPK inhibitor SB202190 inhibited TGF-–induced 12/15-LO, collagen 1(I), and FN expression. Thus, MAPK seem to play important roles in mediating TGF- and 12/15-LO interaction and ECM accumulation.
To evaluate further the functional significance in DN, we examined the consequences of 12/15-LO blockade on HG-induced TGF- mRNA expression by using a novel Rz targeted to cleave rat 12/15-LO and also tested the 12/15-LO shRNA. Rz are RNA enzymes that catalytically cleave specific RNA sequences, resulting in irreversible inactivation of the target RNA (45,46). We showed earlier that a Rz directed to cleave rat leukocyte-type 12/15-LO was effective in vitro in VSMC and in vivo in a rat model of neointimal thickening (47). Furthermore, a modified new generation "short" Rz to rat 12/15-LO could attenuate Ang II–induced FN expression in RMC (31). In this study, we showed that the "short" 12/15-Rz but not mRz could inhibit HG-induced TGF- mRNA expression in RMC. Similarly, new 12/15-LO shRNA also inhibited HG-induced TGF- mRNA expression. These results suggest that HG-induced TGF- is mediated, at least in part, by the 12/15-LO pathway and also illustrate the utility of Rz and shRNA to reduce expression of genes related to the pathogenesis of DN.
Although we mainly used MC in these studies, 12/15-LO and TGF- interactions may occur in other relevant renal cells, such as podocytes. This is supported by the recent report that increased podocyte 12/15-LO expression is also observed in experimental DN and in HG-stimulated cultured podocytes (48). In summary, our study demonstrates a novel interaction between 12/15-LO and TGF- actions in mediating MC matrix deposition and glomerulosclerosis associated with DN. HG- or diabetes-induced TGF- and 12/15-LO activation may influence each other to amplify downstream signaling pathways and gene expression. Thus, new strategies aimed at combined blockade of TGF- as well as 12/15-LO may yield optimal therapeutic benefits.
|
Acknowledgments |
|---|
We thank Dr. Colin Funk for the mouse 12/15-LO cDNA.
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 in patients with type II diabetes.
Diabetes 46
: 854
–859, 1997[Abstract]
on renal extracellular matrix components and their regulating proteins.
J Am Soc Nephrol 10
: 2109
–2119, 1999(TGF) and platelet-derived growth factor (PDGF) on fibronectin and collagen type IV mRNA.
J Cell Physiol 163
: 451
–457, 1995[CrossRef][Medline]
1.
Am J Physiol 275
: F458
–F466, 1998
antibody in db/db diabetic mice.
Proc Natl Acad Sci U S A 97
: 8015
–8020, 2000/SMAD signaling pathway is present and functional in human mesangial cells.
Kidney Int 56
: 1354
–1365, 1999[CrossRef][Medline]
1-induced collagen I expression in human mesangial cells.
Am J Physiol Renal Physiol 285
: F413
–422, 2003 induced 2(I) collagen in human glomerular mesangial cells.
J Biol Chem 276
: 6983
–6992, 20011(I) collagen by TGF-1 in mesangial cells: Role of the p38MAPK pathway.
Am J Physiol Renal Physiol 280
: F495
–F504, 2001 is elevated in human and experimental diabetic nephropathy.
Proc Natl Acad Sci U S A 90
: 1814
–1818, 19931 mRNA in patients with diabetes mellitus.
Kidney Int 49
: 1120
–1126, 1996[Medline]
1 activates MAP kinase in human mesangial cells: A possible role in collagen expression.
Kidney Int 56
: 1710
–1720, 1999[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  E. M. Abdel-Rahman, P. M. Abadir, and H. M. Siragy Regulation of renal 12(S)-hydroxyeicosatetraenoic acid in diabetes by angiotensin AT1 and AT2 receptors Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1473 - R1478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Yuan, L. Lanting, Z.-G. Xu, S.-L. Li, P. Swiderski, S. Putta, M. Jonnalagadda, M. Kato, and R. Natarajan Effects of cholesterol-tagged small interfering RNAs targeting 12/15-lipoxygenase on parameters of diabetic nephropathy in a mouse model of type 1 diabetes Am J Physiol Renal Physiol, August 1, 2008; 295(2): F605 - F617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-G. Xu, H. Yuan, L. Lanting, S.-L. Li, M. Wang, N. Shanmugam, M. Kato, S. G. Adler, M. A. Reddy, and R. Natarajan Products of 12/15-Lipoxygenase Upregulate the Angiotensin II Receptor J. Am. Soc. Nephrol., March 1, 2008; 19(3): 559 - 569. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Guha, Z.-G. Xu, D. Tung, L. Lanting, and R. Natarajan Specific down-regulation of connective tissue growth factor attenuates progression of nephropathy in mouse models of type 1 and type 2 diabetes FASEB J, October 1, 2007; 21(12): 3355 - 3368. [Abstract] [Full Text] [PDF]
|
|
|
