Nephrogenic Factors Promote Differentiation of Mouse Embryonic Stem Cells into Renal Epithelia
Doyeob Kim and
Gregory R. Dressler
Department of Pathology, University of Michigan, Ann Arbor, Michigan
Address correspondence to: Dr. Gregory R. Dressler, University of Michigan, Department of Pathology, MSRB1, Room 4510, 1150 West Medical Center Drive, Ann Arbor, MI 48109. Phone: 734-764-6490; Fax: 734-763-6640; dressler{at}umich.edu
Received for publication May 24, 2005.
Accepted for publication September 28, 2005.
Embryonic stem (ES) cells have been induced to differentiatein vitro into a broad spectrum of specialized cell types, includinghematopoietic, pancreatic, and neuronal cell types. Such ES-derivedcells can provide a valuable source of progenitor cell types.Whereas undifferentiated ES cells can become integrated intoa developing kidney and contribute to tubular epithelia, theability to generate renal precursor cells in vitro has not beenreported. This study used a combination of nephrogenic growthfactors to differentiate ES cells into renal epithelial cellsthat are capable of integrating into a developing kidney withvery high efficiency. Using a combination of retinoic acid,Activin-A, and Bmp7, cultured ES cells can be induced to expressmarkers specific for the intermediate mesoderm, from which thekidneys arise. Embryoid bodies that are cultured in the presenceof nephrogenic factors can respond to inductive signals andform epithelial structures in vitro. When injected into developingkidney rudiments, treated ES cells contribute to tubular epitheliawith near 100% efficiency. These methods may facilitate thelarge-scale culture of renal epithelial precursor cells fora variety of applications.
Embryonic stem (ES) cells provide a potentially unlimited sourcefor generating highly specialized cells and tissues in vitro.Such in vitroproduced cells can be excellent model systemsfor physiologic studies and may ultimately have therapeuticapplications. Indeed, ES cells can be directed to differentiatealong specific cell lineage pathways, such as pancreatic cells(1,2), motor neurons (3), and hematopoietic cells (4). The abilityto differentiate ES cells selectively depends in part on secretedgrowth and differentiation factors that mimic the environmentof a particular cell lineage. Recently, Steenhard et al. (5)injected undifferentiated ES cells into developing kidneys andshowed integration into tubules with an efficiency approaching50%. However, in vitro differentiation of ES cells into renalepithelial precursor cells has not been reported. Given thefrequency of both chronic and acute renal failure in adultsand the limited ability of renal tubular epithelial cells toregenerate in vivo, the possibility of cell replacement therapyby renal progenitor cells merits investigation. To begin directingES cell differentiation toward the renal epithelial lineage,intimate knowledge of early development is essential.
In birds and mammals, the mesoderm is compartmentalized alongthe mediolateral axis into paraxial, intermediate, and the lateralplate mesoderm. Much of the urogenital system is derived fromthe intermediate mesoderm, which undergoes sequential patterninginto pro-, meso-, and metanephric structures along the anterior-posterioraxis (6). The Pax2 and Pax8 genes are expressed early in theintermediate mesoderm and are required for formation of thefirst epithelial ducts (7). In the chick embryo, activationof Pax2 expression requires signals from paraxial mesoderm,although these remain largely uncharacterized (8). The adultkidney, or metanephros, is formed by reciprocal inductive interactionsbetween the ureteric bud epithelium and the metanephric mesenchyme.This induced mesenchyme is thought to provide a pool of renalstem cells that are capable of generating much of the tubularand glomerular epithelia (9). Among the early genes expressedin the metanephric mesenchyme are Pax2, Wt1, gdnf, six1, andsix2 (6,10,11). Subsequent to induction, many additional secretedfactors, including Wnts and bone morphogenic proteins (BMP),stimulate epithelia cell differentiation and refine the patternof the developing nephron.
In this report, we use the known markers and biochemical pathwaysfor early kidney development to differentiate ES cells intorenal epithelial progenitor cells. On the basis of pioneeringwork in the Xenopus embryo (12,13), retinoic acid (RA) and Activinwere used to stimulate expression of early intermediate mesodermalmarkers. Addition of Bmp7 further enhanced the ability of thesecells to contribute to developing tubules in a kidney organculture system. Our data define a nephrogenic cocktail of factorsthat promote differentiation into intermediate mesoderm-likecells and ultimately renal epithelial cells. Such in vitrogeneratedcells may be very useful for the development of bioartificialorgans (14) or cell-based therapies in chronic or acute renalfailure.
Cell Culture and Microinjection into Kidneys
Mouse ES cells (R26) were grown in high-glucose DMEM (Life TechnologiesBRL, Gaithersburg, MD), 10% FBS (Atlanta Biologicals, Atlanta,GA), 0.1 mM -mercaptoethanol (Sigma, St. Louis, MO), 4 mM glutamine(Life Technologies BRL), 20 units/ml PEN/STREP (Life TechnologiesBRL), 0.1 mg/ml G418 (Life Technologies BRL), and 103 units/mlrat leukemia inhibitory factor (rLIF) (Chemicon, Temecula, CA)on a 0.1% gelatin-coated tissue culture plate at 37°C with5% CO2 and 95% air for 2 d. The ES cells were dissociated with0.05% trypsin plus 0.53 mM EDTA (Life Technologies BRL) andtransferred to a 100-mm bacteriological petri dish (BD Falcon,San Jose, CA) to induce embryoid body (EB) formation. The EBsuspension was cultured in the same medium without rLIF for2 d and then transferred to 60-mm tissue culture plates coatedwith 0.1% gelatin. Each 60-mm tissue culture plate containedapproximately 100 EB. The EB were grown without growth factorsor in the presence of the following growth factors: 0.1 µMRA, 10 ng/ml activin-A, 50 ng/ml Bmp4, or 50 ng/ml Bmp7 (R &D Systems, Minneapolis, MN). The cells were trypsinized andresuspended with 10 µl of PBS to make a final concentrationof 108 cells/ml and microinjected with a very fine needle intoE11.5 or E12.5 embryonic kidneys on a Transwell plate in which0.9 ml of DMEM was added. The kidneys were cultured at 37°Cwith 5% CO2 and 95% air for 3 to 5 d. For in vitro inductionexperiments, EB were cultured on methyl-cellulose plates for5 d with or without nephrogenic factors and then placed nextto a piece of E12.5 spinal cord on a transwell filter.
Reverse TranscriptionPCR Analysis
Total RNA was extracted by using TRIZOL reagent (Life TechnologiesBRL). One unit of DNAse I (Roche, Indianapolis, IN) was addedper microgram of RNA, and the mixture was incubated at 37°Cfor 30 min. Two micrograms of total RNA was reverse transcribedusing Stratascript RT (Stratagene, La Jolla, CA) as the manufacturersprotocol. Two reactions of a negative control were also performedwith water, instead of RNA or without reverse transcriptase.
For real-time PCR, primer pairs were designed using the Primer3program (15). The primer pairs spanning one intron were as follows:Pax-2 GGCATCTGCGATAATGACACA, GGTGGAAAGGCTGCTGAACTT; Lim-1 AATGCAACCTGACCGAGAAG,ACATCATGCAGGTGAAGCAG; GDNF ACGAAACCAAGGAGGAACTGA, TTTGTCGTACATTGTCTCGGC;Eya1 CTAACCAGCCCGCATAGCCG, TAGTTTGTGAGGAAGGGGTAGG; Six2 GCAAGTCAGCAACTGGTTCA,AACTGCCTAGCACCGACTTG; Wnt4 CATCTCTTCAGCAGGTGTGG, GGACGTCCACAAAGGACTGT;WT1 CAGGATGTTCCCCAATGC, CCTCGTGTTTGAAGGAATGG; Cadherin-6 TTTGTGGTCCAAGTCACGGC,CATCGGCATCACTGGCTTTG; Oct-4 AGCTGCTGAAGCAGAAGAGG, GGTTCTCATTGTTGTCGGCT;glyceraldehyde-3-phosphate dehydrogenase (GAPDH) TCCGCCCCTTCTGCCGATG,CACGGAAGGCCATGCCAGTGA; and Synapsin1 GGTCATCGACGAACCGCACA, TCCACCATTGGCATGAGCCA.All pairs are written 5' to 3' with the top and bottom strandsin order.
Real-time PCR was performed using a BioRad iQ iCycler DetectionSystem (BioRad Laboratories, Ltd, Hercules, LA) with SYBR greenfluorophore. Reactions were performed in a total volume of 20µl, including 10 µl of SYBR Green Supermix (BioRadLaboratories, Ltd), 0.1 µl of each primer of a 10-µMstock, and 10 µl of the 10-fold diluted reverse-transcribedcDNA template. The cycling conditions were as follows: Predenaturation(95°C for 3 min) and PCR amplification (40 cycles of 95°Cfor 15 s, 60°C for 30 s, and 72°C for 30 s). All reactionswere carried out in triplicate for every sample. The standardserial 10-fold dilutions of template cDNA and two reactionsof negative control were repeated on every plate. GAPDH wasused for normalization, and relative quantification was analyzedusing iCycler iQ Optical System Software Version 3.0a (BioRadLaboratories, Ltd).
Immunocytochemistry
EB were fresh frozen in OCT and sectioned at 10 µ in acryostat. After air drying, sections were fixed in 3% paraformaldehydefor 10 min and washed in PBS and 0.1% Tween 20 (PBST). Antibodieswere incubated for 2 h at room temperature in PBST and 2% goatserum. The primary antibodies used were rabbit anti-Pax2 (CovanceInc., Princeton, NJ), mouse anti-pan-cytokeratin (Sigma), mouseantiE-cadherin (Cell Signaling Technology, Beverly, MA),mouse antib-catenin (Cell Signaling Technology), rabbitanti-laminin (Sigma), and FITC-lotus tetragonobulus agglutinin(LTA; Sigma). After washing two times in PBST, fluorescence-conjugatedsecondary antibodies were used. Controls included second antibodiesonly to ensure specificity. Images were captured on a NikonES800 fluorescence scope with a SPOT digital camera.
LacZ Staining
For whole mounts, kidney rudiments were fixed in 0.2% glutaraldehyde,1% formaldehyde, and 0.02% NP-40 in PBS for 10 min at room temperature;washed in PBS; and stained overnight at room temperature inPBS with 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, and 1 mg/mlX-Gal. After washing in PBS, whole rudiments were incubatedwith anti-laminin (Sigma; 1:100) in PBS, 0.1% Tween-20, 2% goatserum, or FITC-conjugated lectin tetragonobulus (Sigma; 1:50).Detection of anti-laminin was with TRITC-conjugated anti-rabbitsecondary antibodies. Washes were done at room temperature threeor four times in PBS and 0.1% Tween-20. For staining of sections,fresh-frozen kidney rudiments were cut at 25 µ and fixedas above. Staining was done at 32°C overnight in X-gal buffer,and sections were washed in PBST. Anti-laminin and FITC-conjugatedLTA were used to visualize tubules.
To examine the ability of ES cells to differentiate into intermediatemesoderm under controlled conditions, we first formed EB inculture over a 5-d period. The Rosa26 ES cell line was usedin this study as it is tagged with a ubiquitously expressedlacZ gene. Subsequently, the EB were cultured with increasingconcentrations of BMP, RA, or Activin-A and grown for an additional5 d and analyzed for Pax2 protein expression (Figure 1A). Theconcentrations of RA and Activin-A and BMP ranged in 10-foldincrements from 106 to 1012 M and 1 to 100 ng/ml,respectively. BMP are known to induce mesoderm and hemangioblastsin ES cell cultures (16,17), whereas RA and Activin in combinationare able to expand the pronephric field in the Xenopus embryo(18). Experiments with RA and Activin in combination generatedthe highest levels of Pax2 protein (Figure 1A). Bmp4 alone showedsome increase in Pax2 at low doses but none at higher doses,whereas Bmp7 treatment showed low levels of Pax2 at high doses.Although Pax2 is one of the earliest markers in the intermediatemesoderm, it is also expressed in differentiated commissuralneurons of the spinal cord and in the midbrain/hindbrain junction.
Figure 1. Gene expression analysis in embryoid bodies (EB) after addition of differentiation promoting factors. (A) Western blotting for Pax2 after addition of factors to EB. Activin-A, bone morphogenic protein 4 (BMP4), BMP7, or retinoic acid (RA) was added at increasing concentrations to EB and cultured for 5 d. Equal amounts of protein lysates were loaded and probed with anti-Pax2. EB that were cultured without factors served as a negative control (C). Activin-A was also added in combination with 107 M RA. The arrow indicates the 48-kD Pax2b protein. (B) Total RNA was extracted from cells after 5 d of culture with control medium or addition of growth factors and assayed for gene-specific expression by semiquantitative (top) and real-time reverse transcriptionPCR (mean and SD). Lanes are as follows: ES, undifferentiated ES cells; EB, embryoid bodies without growth factors or rLIF; RA, EB with 0.1 µM RA and 10 ng/ml Activin-A; RA4, 0.1 µM RA, 10 ng/ml Activin-A, and 50 ng/ml BMP4; RA7, 0.1 µM RA, 10 ng/ml Activin-A, and 50 ng/ml BMP7. For semiquantitative PCR, input RNA were adjusted so that equal amounts of glyceraldehyde-3-phosphate dehydrogenase were amplified in each sample. Real-time data are shown below each panel as the mean relative amount of three independent runs with 1 SD. The neuronal marker Synapsin-1 was tested by real-time PCR only. The amount of RNA measured in untreated EB was arbitrarily assigned the value of 1.0.
To assess the efficacy of growth and differentiation factorsmore completely, we isolated RNA from EB and tested them byreal-time reverse transcriptionPCR for the expressionof early nephrogenic markers (6,19). The Pax2 and lim1 genesare among the earliest markers of the intermediate mesoderm,from which the renal epithelial cells arise. Subsequently, Pax2is expressed in all epithelial precursors of the kidney. TheWt1 gene is expressed at low levels in renal mesenchyme andepithelial cells and at high levels in the podocytes. The Eya1,Six2, and gdnf genes are expressed in early kidney mesenchymebut not their epithelial derivatives. Wnt4 is highly expressedin early mesenchymal aggregates and their epithelial derivatives,whereas cadherin-6 is an early marker for proximal tubule (PT)precursors. Oct4 expression is a marker of pluripotency in EScells and is not found in more differentiated lineages (20).
A significant shift in the pattern of gene expression was evidentupon addition of RA and differentiation promoting factors (Figure 1B).In the absence of LIF, the EB express a large set of markersthat reflect, in part, the heterogeneity of the EB. Some ofthe markers, such as Wnt4, Six2, and lim1, were increased inEB, compared with ES cells, in the absence of any factors. Thismay reflect their heterogeneous expression patterns in manycell types other than intermediate mesoderm, as the EB differentiaterandomly. However, the combination of RA and Activin-A was highlyeffective in stimulating Pax2 and Wt1 induction more than 20-and 30-fold, respectively. Consistent with the loss of pluripotency,the expression of Oct4 was suppressed in EB and in all treatedcultures. The expression of Eya1, gdnf, and cadherin-6 alsoincreased in RA-treated EB. Further addition of Bmp4 (RA4) suppressedexpression of early intermediate mesoderm-specific markers,such as lim1, Pax2, and Wt1. However, Bmp7-treated EB (RA7)reduced Pax2 and Wt1 levels to a much lesser extent than Bmp4while increasing cadherin-6, gdnf, lim1, and Eya1 levels. Theneural specific marker synapsin-1 showed approximately a two-foldincrease in expression upon RA treatment that was unaffectedby Bmp7.
The induction of Pax2, Wt1, lim1, gdnf, and cadherin-6 indicatedthat at least some of the cells within the EB expressed markersthat are appropriate but not necessarily exclusive for intermediatemesoderm and early derivatives of the metanephric mesenchyme.To gauge the proportion of cells within the EB that expressthese markers, we used immunohistochemistry on sections throughtreated and control EB (Figure 2). Widespread nuclear Pax2 stainingwas evident in EB that were cultured in our nephrogenic cocktailbut not in control EB (Figure 2, A and B). Large patches ofE-cadherinpositive cells were also observed, exhibitingthe characteristic cell surface staining. These E-cadherinpositiveregions covered much more area in the EB that were culturedwith nephrogenic factors. Similarly, cytokeratins were observedin control EB, but many more positive areas were seen in treatedEB. In treated cultures, some Pax2-positive cell clusters alsoexpressed E-cadherin and epithelial cytokeratins and were surroundedby a laminin-containing basement membrane (Figure 2, C and D).In treated cultures, cytokeratin-expressing cells were frequentlynear cells that expressed cadherin-6, but these markers wererarely expressed in the same cells (Figure 2, E and F). In controlEB, few cells exhibited the characteristic cell surface expressionof cadherin-6. Strong laminin staining was found throughoutthe treated EB, although this was mostly not in defined tubularstructures but rather more filamentous throughout the EB (Figure 2,G and H). In control EB, laminin staining was not very prominent.Secondary antibodies alone showed no staining in any sectionsexamined (data not shown).
Figure 2. Immunostaining of EB. EB were cultured for 5 d in methylcellulose-treated dishes with and without nephrogenic factors (RA7) and sectioned. (A) RA7-treated EB stained for Pax2 (red) and -catenin (green). Note the high percentage of Pax2-positive cells. (B) Control EB that were cultured without factors stained for Pax2 (red) and -catenin (green). (C) RA7-treated EB stained for Pax2 (red) and E-cadherin (green). Note Pax2 expression in E-cadherinpositive structures (arrow). (D) Neighboring section to C stained for laminin (red) and cytokeratin (green). (E) RA7-treated EB stained for cadherin-6 (red) and cytokeratin (green). Note the juxtaposition of cytokeratin-positive cells (arrowhead) and cadherin-6positive cells (arrow). Expression of these markers did not overlap. (F) Control EB stained for cadherin-6 (red) and cytokeratin (green). No cadherin-6 staining was observed. (G) RA7-treated EB stained for laminin (red). Strong, filamentous laminin staining was found throughout the EB but was generally not consistent with basement membranetype staining. (H) Control EB stained for laminin (red). Magnification bars = 100 µ.
The metanephric mesenchyme expresses both Pax2 and Wt1 beforeinduction by the ureteric bud and epithelial cell polarization.Induction can be mimicked in vitro by co-culturing metanephricmesenchyme with embryonic spinal cord, a strong heterologousinducer. Thus, EB that were cultured in nephrogenic factorswere placed next to isolated embryonic spinal cord on Transwellfilters (Figure 3). After 4 d in culture, spinal cord inducedmultiple epithelial cysts and tubule-like structures in EB thatwere treated with nephrogenic factors (Figure 3, A, C, and Ethrough G). Many but not all of these epithelial structuresexpressed Pax2, and all expressed E-cadherin. Pax2-positiveepithelial structures were frequently surrounded by laminin-containingbasement membranes. EB that were cultured in control mediumalone did not respond well to inductive signals. Some E-cadherinpositiveregions were observed, but these remained flattened and didnot resemble epithelial cysts or tubules (Figure 3, D and H).
Figure 3. Co-culture of EB with spinal cord. EB were cultured for 5 d with or without nephrogenic factors, placed next to embryonic spinal cord on a transwell filter, and cultured for an additional 4 d. (A) Phase contrast of RA7-treated EB surrounding a piece of E12.5 spinal cord (sc). (B) Phase contrast of control EB surrounding a piece of E12.5 sc. (C through H) Whole-mount antibody staining for Pax2 (red), E-cadherin (green), and laminin (blue) of EB after co-culture with sc. (C) RA7-treated EB exhibit Pax2-positive tubules (arrows) that also express E-cadherin and are surrounded by laminin-containing basement membrane. Some large E-cadherinpositive aggregates that do not express Pax2 (arrowhead) are also present. (D) Control EB exhibit no Pax2-positive tubules, diffuse laminin staining, and the occasional E-cadherinpositive aggregate. (E through G) Examples of tubules found in RA7-treated EB after co-culture with sc. (H) Typical control EB after co-culture with sc. Magnification bars = 500 µ for A and B and 100 µ for C through H.
If cells within the treated EB differentiated along the intermediatemesodermal lineage, then they should be able to become integratedinto a developing kidney. Thus, we isolated EB after 5 to 7d of culture, using the cocktail of nephrogenic factors describedabove, and microinjected approximately 10 to 20 nl of the cellsuspension (1000 to 2000 cells) into cultured kidney rudimentsthat had been dissected from E12.5 embryos and placed on Transwellfilters. After the kidney rudiments were cultured for an additional4 to 5 d, lacZ staining on whole mounts and cryosections andfluorescence antibody staining were performed with the kidneyrudiments (Figure 4). Kidneys that were injected with cellsthat were isolated from treated EB exhibited lacZ staining intubules throughout the organ culture (Figure 4, A through D).These lacZ-positive cells were almost exclusively found in tubularstructures, as determined by staining with anti-laminin. Incontrast, cells that were isolated from EB without any furthertreatment exhibited far fewer lacZ-positive tubules and largepatches of lacZ-positive cells along the peripheral mesenchymeand within the interstitium (Figure 4, E through H) that moreclosely resembled undifferentiated cells, much like small EB.Using images that were obtained from sections of five independentlyinjected kidney rudiments, we calculated the area of lacZ stainingin tubules and nontubular structures. For RA7-treated cells,it was difficult even to find and measure lacZ-positive cellsor regions that were not epithelial. Thus, we believe that theefficiency of incorporation of treated EB cells approaches 100%.For untreated EB-derived cells, the area of lacZ-positive stainingfound in nontubular structures ranged from 31 to 85% with amean of 60% (± 19.7%). Thus, approximately 40% of lacZ-positivestaining was found in epithelial tubules when untreated EB cellswere injected into kidney rudiments. These, numbers reflectpercentage of surface area and not numbers of cells. In theabsence of Bmp7, the proportion of lacZ-positive tubules wasreduced, whereas addition of 100 ng/ml Bmp4 completely inhibitedthe ability of EB cells to contribute to tubules in vitro (datanot shown).
Figure 4. Injection of EB-derived cells into E12.5 cultured kidneys. Cryosections from kidney rudiments were stained for lacZ expression (A, C, E, and G) and with anti-laminin antibodies (B, D, F, and H). (A through D) LacZ-positive cells from RA7-treated EB were found predominantly in tubular structures (arrows), with virtually no detectable lacZ-positive cells in interstitial or mesenchymal cells. (E through H) Many lacZ-positive cells from control EB were found in large and small aggregates (arrows) that remained mesenchymal in appearance and were not surrounded by laminin-containing basement membranes. Some blue cells from control EB were also found in tubules. Magnification bars = 100 µ. More images can be seen in supplemental Figures 1 and 2 (available online at http://www.jasn.org).
To characterize better the nature of the lacZ-positive tubulesthat were derived from treated EB cells, we used whole mountsand sections from kidney rudiments 4 or 5 d after injection(Figure 5). LacZ-positive cells could be found in tubules thatconnected to developing Bowmans capsules but were neverfound in glomerular tufts (Figure 5, A and B). That many lacZ-positivetubules were developing PT was confirmed by co-staining withanti-laminin and LTA (Figure 5, C through F). FITC-LTA stainsthe lumens of PT during development (21) and co-localized withsome but not all LacZ-positive cells in treated cultures. Untreatedcontrol EB cells rarely co-localized with LTA-positive tubules,and LacZ-positive clusters were mesenchymal in appearance (Figure 5,G and H). Thus, EB cells that were treated with the RA7 nephrogeniccocktail were able to contribute to developing tubules withincreased frequency, compared with untreated EB cells.
Figure 5. Characterization of EB-derived tubule cells. E12.5 kidney rudiments were injected with RA7-treated EB cells (A through F) or control EB cells (G and H) and stained for lacZ, laminin, and lotus tetragonobulus agglutinin (LTA) binding. (A) Whole-mount lacZ staining of tubule shows lacZ-positive cells at the developing glomerular/proximal tubule (PT) junction. Arrows point to glomerular tufts. (B) Laminin staining of same tissue as in A. (C and D) Co-localization of lacZ-positive cells in developing PT (arrows) that also stain with LTA lectin (green) and are surrounded by laminin-containing basement membranes (red). (E and F) Another developing PT derived from RA7-treated EB cells (arrow) stained as above. (G and H) Many control EB cells localize to interstitial and peripheral mesenchyme (arrows), although a small number of lacZ-positive cells are also found in tubules.
In this report, we examine the ability of ES cells to differentiateinto the renal progenitor cells of the intermediate mesoderm.A combination of RA, Activin-A, and Bmp7 effectively inducedthe expression of intermediate mesodermal markers in EB. Thesedata are consistent with the observation that both RA and Activincan induce pronephric markers in the Xenopus animal cap assay(12). Although the EB are still a heterogeneous mixture of cells,many expressed more differentiated markers found in the derivativesof the metanephric mesenchyme when treated with RA7. Furthermore,when placed into the environment of a developing kidney rudiment,these EB cells could generate tubules with very high efficiency,at least some of which expressed PT markers. Thus, we believethat pretreatment of EB with the RA7 nephrogenic cocktail, althoughnot generating true epithelial cells in vitro, predisposes theEB cells to differentiate along the renal epithelial lineagesimilar to the potential of the intermediate mesoderm.
The metanephric mesenchyme by itself does not form tubules unlessinduced by the ureteric bud or a heterologous inducer, suchas spinal cord or exogenous Wnt proteins (22). Pax2 expressionin the mesenchyme is essential for enabling these mesenchymalcells to respond to inductive signals (23). Although few tubulesare observed in the EB that are cultured with the RA7 nephrogeniccocktail, many Pax2-positive tubules are observed after theseEB are co-cultured with embryonic spinal cord. These data suggestthat the treated EB are primed to respond to inductive signals,similar to the metanephric mesenchyme. Furthermore, once injectedinto a developing kidney rudiment, RA7-pretreated cells werefound exclusively in epithelial tubules. We also observed thatuntreated EB cells can contribute to kidney tubules in the absenceof any pretreatment. After untreated EB cells were injectedinto kidney rudiments, the mean area of lacZ-positive tubuleswas approximately 40% of the total lacZ-positive area in a kidneysection. Given that the epithelial cells are in general muchlarger than the less differentiated, nonepithelial component,the number of cells that contribute to tubules is likely tobe even less than 40%. Steenhard et al. (5) showed that undifferentiatedES cells were capable of integrating into a developing kidneywith approximately 50% efficiency. In these experiments, ESwere not allowed to form EB and thus may retain more plasticity.Clearly, the environment of the developing kidney can directdifferentiation even in the absence of any treatment.
Injection of RA7-primed EB cells into kidney organ culturestakes full advantage of an environment that is conducive totubule formation. Just as the host metanephric mesenchymal cellsare induced, form aggregates, and become polarized epithelia,the injected cells from treated EB are able to integrate intopolarized epithelial tubules. However, a major concern regardingthe cell injection experiments is the potential for cell fusion.This has been a contentious issue within the stem cell field,as some of the early reports of stem cellderived tissuereplacement may have been due to cellcell fusion ratherthan differentiation and integration into the target tissue(24). One argument against cell fusion in our system is thatwe obtain less integration of ES-derived cells into tubuleswithout the addition of exogenous factors. Terada et al. (25)showed that the spontaneous cell fusion in their study occurredat a very low rate, two to 11 clones per 106 bone marrow (BM)-derivedcells. Compared with that rate, it is unlikely that the manylacZ-positive cells observed upon injection of 103 RA7-treatedcells are due to cell fusion events, yet it is still formallypossible that treatment of ES cells with cocktails of differentiationfactors alters the potential of cells to fuse in the kidneyrudiment system. We tested the issue of cell fusion with a geneticapproach. The reporter ES cell line R26R-EYFP (26) containsa targeted insertion of enhanced yellow fluorescence protein(EYFP) into the ROSA26 locus, preceded by a loxP-flanked stopsequence. These ES cells were treated with the nephrogenic cocktailand microinjected into kidney rudiments that were isolated fromKsp-Cre transgenic mice (27), which express Cre recombinasein the some but not all kidney epithelia. Cell fusion of R26R-EYFPwith Cre-expressing host cells should activate the fluorescencemarker. After injection of eight Ksp-Cre transgenic kidney rudiments,we did not observe a single EYFP-expressing cell in live orfixed cultures, suggesting little to no cell fusion with hosttubules at this level of detection (data not shown).
The ability to differentiate ES cells along certain lineagepathways may provide an unlimited source of stem cells for avariety of applications. In the kidney, PT cells can regenerateafter toxic or ischemic injury, yet despite many advances inunderstanding the cell physiology of acute renal failure, thehigh frequency of mortality in the clinical setting has notdipped significantly below 50% (28). The apparent rate-limitingstep in the ability of patients to recover from acute tubularnecrosis (ATN) is the regeneration of the PT. Recent reportshave demonstrated BM-derived PT cells in mice that were subjectedto ischemia-reperfusion (29,30) and cisplatin treatment (31).In these experiments, the majority of regenerated PT cells seemedto be derived from donor BM stem cells that were injected intravenouslyafter injury, yet in three independent studies using eitherthe folic acid model of ATN (32) or the ischemia model (33,34),regenerated PT cells that were derived from BM months aftertransplantation were not observed with any significant frequency.However, in one study, human mesenchymal stem cells that werederived from BM were able to become incorporated into a developingkidney in culture (35). Given the conflicting results obtainedwith BM-derived stem cells, it seems appropriate to try othercell-based therapies, including cells derived from the onlytrue pluripotential cell, the ES cell. Furthermore, cell-baseddialysis machines, or bioartificial kidneys, are currently undergoingclinical trials for ATN (14). As promising as such devices maybe, they suffer from the limitations of available cell sourcesfor seeding the filtration barriers, high manufacturing costs,and limited storage potential. Thus, it seems prudent to tryto develop new sources of potential PT precursors that couldbe infused rapidly into patients, shortly after suffering renaldamage, or could be used for improved bioartificial dialysis.Our finding that ES cells can give rise to an unlimited andeconomically viable source of PT precursor cells may providea starting point for developing new cell-based therapies inthe treatment of chronic and acute renal disease.
Acknowledgments
This project was supported by a fellowship from the AmericanFoundation for Urologic Disease to D.K. and National Institutesof Health grants DK054740 and DK069689 to G.R.D.
We thank F. Costantini for the R26R-EYFP ES cells, P. Sorianofor the Rosa26 ES cells, and K.S. OShea for initial helpwith the generation of EB.
Footnotes
Supplemental information for this article is available onlineat http://www.jasn.org/
Lumelsky N, Blondel O, Laeng P, Velasco I, Ravin R, McKay R: Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets.
Science292
:1389
1394,2001[Abstract/Free Full Text]
Kania G, Blyszczuk P, Czyz J, Navarrete-Santos A, Wobus AM: Differentiation of mouse embryonic stem cells into pancreatic and hepatic cells.
Methods Enzymol365
:287
303,2003[CrossRef][Medline]
Wichterle H, Lieberam I, Porter JA, Jessell TM: Directed differentiation of embryonic stem cells into motor neurons.
Cell110
:385
397,2002[CrossRef][Medline]
Daley GQ: From embryos to embryoid bodies: Generating blood from embryonic stem cells.
Ann N Y Acad Sci996
:122
131,2003[Medline]
Steenhard BM, Isom KS, Cazcarro P, Dunmore JH, Godwin AR, St John PL, Abrahamson DR: Integration of embryonic stem cells in metanephric kidney organ culture.
J Am Soc Nephrol16
:1623
1631,2005[Abstract/Free Full Text]
Dressler GR: Development of the excretory system. In:
Mouse Development: Patterning, Morphogenesis, and Organogenesis, edited by Rossant J, Tam PT, San Diego, Academic Press,2002
, pp395
420
Bouchard M, Souabni A, Mandler M, Neubuser A, Busslinger M: Nephric lineage specification by Pax2 and Pax8.
Genes Dev16
:2958
2970,2002[Abstract/Free Full Text]
Mauch TJ, Yang G, Wright M, Smith D, Schoenwolf GC: Signals from trunk paraxial mesoderm induce pronephros formation in chick intermediate mesoderm.
Dev Biol220
:62
75,2000[CrossRef][Medline]
Yu J, McMahon AP, Valerius MT: Recent genetic studies of mouse kidney development.
Curr Opin Genet Dev14
:550
557,2004[CrossRef][Medline]
Bouchard M: Transcriptional control of kidney development.
Differentiation72
:295
306,2004[CrossRef][Medline]
Osafune K, Nishinakamura R, Komazaki S, Asashima M: In vitro induction of the pronephric duct in Xenopus explants.
Dev Growth Differ44
:161
167,2002[CrossRef][Medline]
Carroll TJ, Vize PD: Synergism between Pax-8 and lim-1 in embryonic kidney development.
Dev Biol214
:46
59,1999[CrossRef][Medline]
Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers.
Methods Mol Biol132
:365
386,2000[Medline]
Wiles MV, Johansson BM: Analysis of factors controlling primary germ layer formation and early hematopoiesis using embryonic stem cell in vitro differentiation.
Leukemia11[Suppl 3]
:454
456,1997
Wiles MV, Johansson BM: Embryonic stem cell development in a chemically defined medium.
Exp Cell Res247
:241
248,1999[CrossRef][Medline]
Ariizumi T, Asashima M: In vitro induction systems for analyses of amphibian organogenesis and body patterning.
Int J Dev Biol45
:273
279,2001[Medline]
Davies JA, Fisher CE: Genes and proteins in renal development.
Exp Nephrol10
:102
113,2002[CrossRef][Medline]
Fuhrmann G, Chung AC, Jackson KJ, Hummelke G, Baniahmad A, Sutter J, Sylvester I, Scholer HR, Cooney AJ: Mouse germline restriction of Oct4 expression by germ cell nuclear factor.
Dev Cell1
:377
387,2001[CrossRef][Medline]
Cho EA, Patterson LT, Brookhiser WT, Mah S, Kintner C, Dressler GR: Differential expression and function of cadherin-6 during renal epithelium development.
Development125
:4806
4815,1998
Kispert A, Vainio S, McMahon AP: Wnt-4 is a mesenchymal signal for epithelial transformation of metanephric mesenchyme in the developing kidney.
Development125
:4225
4234,1998[Abstract]
Brophy PD, Ostrom L, Lang KM, Dressler GR: Regulation of ureteric bud outgrowth by Pax2-dependent activation of the glial derived neurotrophic factor gene.
Development128
:4747
4756,2001[Abstract/Free Full Text]
Ying QL, Nichols J, Evans EP, Smith AG: Changing potency by spontaneous fusion.
Nature416
:545
548,2002[CrossRef][Medline]
Terada N, Hamazaki T, Oka M, Hoki M, Mastalerz DM, Nakano Y, Meyer EM, Morel L, Petersen BE, Scott EW: Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion.
Nature416
:542
545,2002[CrossRef][Medline]
Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, Costantini F: Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus.
BMC Dev Biol1
:4
,2001[CrossRef][Medline]
Shao X, Somlo S, Igarashi P: Epithelial-specific Cre/lox recombination in the developing kidney and genitourinary tract.
J Am Soc Nephrol13
:1837
1846,2002[Abstract/Free Full Text]
Liu KD: Molecular mechanisms of recovery from acute renal failure.
Crit Care Med31
:S572
581,2003[CrossRef][Medline]
Lin F, Cordes K, Li L, Hood L, Couser WG, Shankland SJ, Igarashi P: Hematopoietic stem cells contribute to the regeneration of renal tubules after renal ischemia-reperfusion injury in mice.
J Am Soc Nephrol14
:1188
1199,2003[Abstract/Free Full Text]
Kale S, Karihaloo A, Clark PR, Kashgarian M, Krause DS, Cantley LG: Bone marrow stem cells contribute to repair of the ischemically injured renal tubule.
J Clin Invest112
:42
49,2003[CrossRef][Medline]
Morigi M, Imberti B, Zoja C, Corna D, Tomasoni S, Abbate M, Rottoli D, Angioletti S, Benigni A, Perico N, Alison M, Remuzzi G: Mesenchymal stem cells are renotropic, helping to repair the kidney and improve function in acute renal failure.
J Am Soc Nephrol15
:1794
1804,2004[Abstract/Free Full Text]
Szczypka MS, Westover AJ, Clouthier SG, Ferrara JL, Humes HD: Rare incorporation of bone marrow-derived cells into kidney after folic acid-induced injury.
Stem Cells23
:44
54,2005[Abstract/Free Full Text]
Lin F, Moran A, Igarashi P: Intrarenal cells, not bone marrow-derived cells, are the major source for regeneration in postischemic kidney.
J Clin Invest115
:1756
1764,2005[CrossRef][Medline]
Duffield JS, Park KM, Hsiao LL, Kelley VR, Scadden DT, Ichimura T, Bonventre JV: Restoration of tubular epithelial cells during repair of the postischemic kidney occurs independently of bone marrow-derived stem cells.
J Clin Invest115
:1743
1755,2005[CrossRef][Medline]
Yokoo T, Ohashi T, Shen JS, Sakurai K, Miyazaki Y, Utsunomiya Y, Takahashi M, Terada Y, Eto Y, Kawamura T, Osumi N, Hosoya T: Human mesenchymal stem cells in rodent whole-embryo culture are reprogrammed to contribute to kidney tissues.
Proc Natl Acad Sci U S A102
:3296
3300,2005[Abstract/Free Full Text]
This article has been cited by other articles:
E. Rosines, R. V. Sampogna, K. Johkura, D. A. Vaughn, Y. Choi, H. Sakurai, M. M. Shah, and S. K. Nigam Staged in vitro reconstitution and implantation of engineered rat kidney tissue
PNAS,
December 26, 2007;
104(52):
20938 - 20943.
[Abstract][Full Text][PDF]
E. Lazzeri, C. Crescioli, E. Ronconi, B. Mazzinghi, C. Sagrinati, G. S. Netti, M. L. Angelotti, E. Parente, L. Ballerini, L. Cosmi, et al. Regenerative Potential of Embryonic Renal Multipotent Progenitors in Acute Renal Failure
J. Am. Soc. Nephrol.,
December 1, 2007;
18(12):
3128 - 3138.
[Abstract][Full Text][PDF]
L. Reggiani, D. Raciti, R. Airik, A. Kispert, and A. W. Brandli The prepattern transcription factor Irx3 directs nephron segment identity
Genes & Dev.,
September 15, 2007;
21(18):
2358 - 2370.
[Abstract][Full Text][PDF]
C. Vigneau, K. Polgar, G. Striker, J. Elliott, D. Hyink, O. Weber, H.-J. Fehling, G. Keller, C. Burrow, and P. Wilson Mouse Embryonic Stem Cell-Derived Embryoid Bodies Generate Progenitors That Integrate Long Term into Renal Proximal Tubules In Vivo
J. Am. Soc. Nephrol.,
June 1, 2007;
18(6):
1709 - 1720.
[Abstract][Full Text][PDF]
D. Kim, M. Wang, Q. Cai, H. Brooks, and G. R. Dressler Pax Transactivation-Domain Interacting Protein Is Required for Urine Concentration and Osmotolerance in Collecting Duct Epithelia
J. Am. Soc. Nephrol.,
May 1, 2007;
18(5):
1458 - 1465.
[Abstract][Full Text][PDF]
K. L. Price, D. A. Long, N. Jina, H. Liapis, M. Hubank, A. S. Woolf, and P. J. D. Winyard Microarray interrogation of human metanephric mesenchymal cells highlights potentially important molecules in vivo
Physiol Genomics,
January 17, 2007;
28(2):
193 - 202.
[Abstract][Full Text][PDF]
M. H. Little Regrow or Repair: Potential Regenerative Therapies for the Kidney
J. Am. Soc. Nephrol.,
September 1, 2006;
17(9):
2390 - 2401.
[Abstract][Full Text][PDF]
C. Sagrinati, G. S. Netti, B. Mazzinghi, E. Lazzeri, F. Liotta, F. Frosali, E. Ronconi, C. Meini, M. Gacci, R. Squecco, et al. Isolation and Characterization of Multipotent Progenitor Cells from the Bowman's Capsule of Adult Human Kidneys
J. Am. Soc. Nephrol.,
September 1, 2006;
17(9):
2443 - 2456.
[Abstract][Full Text][PDF]