Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gerke, P.
Right arrow Articles by Walz, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gerke, P.
Right arrow Articles by Walz, G.
J Am Soc Nephrol 14:918-926, 2003
© 2003 American Society of Nephrology

Homodimerization and Heterodimerization of the Glomerular Podocyte Proteins Nephrin and NEPH1

Peter Gerke, Tobias B. Huber, Lorenz Sellin, Thomas Benzing and Gerd Walz

Renal Division, University Hospital Freiburg, Freiburg, Germany.

Correspondence to Dr. Gerd Walz, Renal Division, University Hospital Freiburg, Hugstetterstrasse 55, 79106 Freiburg, Germany. Phone: 0761-270-3251; Fax: 0761-270-3245;


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. Nephrin and NEPH1, the gene products of NPHS1 and NEPH1, are podocyte membrane proteins of the Ig superfamily. Similar to the nephrin knockout, mice lacking NEPH1 show severe proteinuria leading to perinatal death. To identify the ligand of NEPH1, the extracellular domain of NEPH1 was fused to human IgG. This NEPH1-Ig fusion protein labeled the glomerular capillary wall of mouse kidneys in a staining pattern identical to NEPH1 and nephrin, prompting speculation that that NEPH1 might form homodimers and/or heterodimers with nephrin. In coimmunoprecipitation and pull-down assays, the NEPH1-Ig fusion protein precipitated wild-type NEPH1 from overexpressing HEK 293T cells. Truncational analysis revealed that the adhesive properties were not confined to a single Ig domain of NEPH1. Fusion proteins containing two Ig domains of NEPH1 were sufficient to immobilize NEPH1, but they failed to interact with control protein containing the phylogenetically related PKD repeats of polycystin-1. NEPH1 also precipitated nephrin, a protein with eight Ig domains and a fibronectin-like domain. Truncational analysis of nephrin revealed a very similar mode of interaction, i.e., two nephrin Ig domains fused to human IgG precipitated either nephrin or NEPH1, but not the control protein. Both NEPH1 and nephrin interactions were strictly dependent upon posttranslational glycosylation, and bacterially expressed protein failed to bind NEPH1. These findings demonstrate that the Ig domains of NEPH1 and nephrin form promiscuous homodimeric and heterodimeric interactions that may facilitate cis- and trans- homodimerizations and heterodimerizations of these molecules at the glomerular slit diaphragm.

E-mail: walz@med1.ukl.uni-freiburg.de


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Renal filtration of small solutes and water without loss of larger molecules is intimately linked to the glomerular basement membrane and the slit diaphragm between interdigitating podocytes. Alterations of these structures, either acquired or hereditary, commonly lead to proteinuria.

Hereditary nephrotic syndromes are a heterogeneous group, displaying severe proteinuria and renal failure. Best-characterized is the congenital nephrotic syndrome of the Finnish type, caused by mutations in NPHS1, the gene encoding nephrin. Affected individuals exhibit massive proteinuria in utero and nephrosis at birth (1). Nephrin is an integral membrane protein located at adjacent sites of secondary foot processes of podocytes, a specialized epithelial cell that ensures size and charge selective ultrafiltration (reviewed in reference 2). The precise function of nephrin is unknown; however, it appears to form a zipper-like filter structure within the approximately 40-nm-wide slits between two foot processes (3).

In mice, the deletion of NEPH1 causes severe proteinuria and perinatal death (4). Like nephrin, NEPH1 is a transmembrane protein of the Ig superfamily expressed by podocytes and localizes to the slit diaphragm by electron microscopy (5). The extracellular domain of NEPH1 contains five Ig domains and the integrin recognition motif RGD. The third Ig domain is similar to the PKD repeat found in polycystin-1, an evolutionary distinct Ig-like fold that appears to mediate strong homophilic interactions (6). Deletion of either nephrin or NEPH1 causes an almost identical phenotype in mice (4,7 ); therefore, it has been speculated that nephrin and NEPH1 participate in identical or overlapping pathways.

In Drosophila, the nephrin- and NEPH1-related proteins hibris (Hbs), kirre/dumbfounded (Duf), irregular chiasm-roughest (IrreC-rst), and sticks and stones (Sns), have been implicated in myoblast fusion and myotube guidance (8). Human nephrin is most closely related to Sns (28% identities) and Hbs (28% identities), whereas NEPH1 is more closely related to Duf (33% identities) and IrreC-rst (31% identities). Interestingly, the deletion of Sns, or combined deletions of Duf and IrreC-rst, abrogate myoblast fusion (9), whereas ectopic overexpression, but not deletion of Hbs, affects muscle development (8). Furthermore, S2 cell aggregation assays revealed a heterotypic interaction of Hbs and Sns with Duf, indicating that the interaction between these proteins may be crucial for muscle development in Drosophila.

These findings prompted us to speculate that NEPH1 is a structural component of the zipper-like structure formed between opposing podocytes (3). To identify ligands of NEPH1, we generated a NEPH1 Ig fusion protein (NEPH1.ec.Fc) and used this fusion protein to stain renal tissue. The NEPH1.ec.Fc fusion protein specifically recognized an antigen along the glomerular capillary wall, closely resembling the staining pattern obtained for NEPH1 and nephrin. This result led to the hypothesis that NEPH1 and nephrin may form homodimeric and heterodimeric interactions at the slit diaphragm of glomerular podocytes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids and Antibodies
Full-length nephrin and NEPH1 cDNAs were recently described (10,11 ). The Fc fusion proteins contain the CH2 and CH3 domain of human IgG. The control protein sFc.7 contains the leader sequence of CD5, followed by the CH2 and CH3 domain of human IgG, and the membrane anchor of CD7. In the sFc fusion proteins, the CD7 anchor was replaced by NEPH1 or nephrin sequences as indicated. All truncations were generated by PCR, and verified by automated sequencing. To generate Nephrin.ec.Fc and Nephrin.Ig1–3, the 5'-oligonucleotide 5'-CGCGGGAAGCTTGCCACCATGGCCCTGGGGACGACGCTCAGGGCTTCTCTCCTGCTC was used with the 3'-oligonucleotides 5'-CGCGGGCAGATCTGAAGGTGGCTCTGTGGGCAG and 5'-CGCGGGCAGATCTTTCTGGGCGGGATAT TTTAC, respectively. The 5'-oligonucleotide 5'-CGCGGGCGAGATCTGGGATCTGCATCCCAG and the 3'-oligonucleotide 5'-CGCG GGGCGGCCGCGCTAGATCGTCACGTTAGTTGG were used to generate sFc.Nephrin.Ig3+4, the 5'-oligonucleotide 5'-CGCGGGCGAGATCTGGCCAACGCATCCGCA and the 3'-oligonucleotide 5'-CGCGGGGCGGCCGCAGACTATGTCCACAG AA were used to generate sFc.Nephrin.Ig5+6, and the 5'-oligonucleotide 5'-CGCGGGCGAGATCTCCAGGACCCCACTGAG and the 3'-oligonucleotide 5'-CGCGGGGCGGCCGCCAGAAGGCTGGTGGAGA were used to generate sFc.Nephrin.7-9. NEPH1.ec.Fc and NEPH1.Ig1+2.Fc were generated using the 5'-oligonucleotide 5'-CGCGGGAAGCTTGCCACCATGACTCTGGAGAGCCCT and the 3'-oligonucleotides 5'-CGCGGGCGGATCCACAGGTAACACCTCTCGCTC and 5'-CGCGGGCGGATCCACATCAAGCTCAATGGATGT, respectively. The 5'-oligonucleotide 5'-CGCGGGGATCCCAATGGCAAGGAGACA and the 3'-oligonucleotide 5'-CGCGGGGCGGCCGCGCTAGGCCCGGCAGGTATAGGTGCCAGC were used to generate sFc.NEPH1.Ig3+4. The domain structures of Nephrin and NEPH1 were predicted using the programs SMART (http://smart. embl-heidelberg.de) and motif scanner (http://scansite.mit.edu/). The NEPH1 antiserum has recently been described (11); the M2 anti-FLAG was obtained from Sigma-Aldrich (Taufkirchen, Germany).

Purification of NEPH1-Fusion Protein
A stable cell line, expressing the NEPH1.ec.Fc fusion protein, was established using the pLXSN retroviral vector system as described earlier (12). In brief, the retroviral vector was produced by cotransfection of HEK 293T cells with three plasmids (2.5 µg of pMD-G, 7.5 µg of pMD-gp, and 10 µg of the retroviral transfer vector containing NEPH1.ec.Fc) using the calcium phosphate method. The supernatant was harvested after 3 d, centrifuged, filtered, and applied to COS M6 cells in the presence of 8 µg/ml polybrene for 4 h. Transduced cells were selected 3 to 4 d after viral transduction in neomycin (500 µg/ml). To purify the secreted NEPH1.ec.Fc fusion protein, supernatants were harvested after 10 to 14 d, centrifuged, filtered, and applied to an anti-human IgG column (ICN Biomedicals, Eschwege, Germany). Bound protein was eluted using 0.1 M glycine (pH 3.0), neutralized in TRIS-buffer, and dialyzed against PBS over night. Concentrations were determined photometrically at 280 nm and by an ELISA using goat-anti human IgG (ICN Biomedicals) coupled to 96-well ELISA plates (Greiner GmbH, Frickenhausen, Germany).

Coimmunoprecipitation
Coimmunoprecipitations were performed as described (10). Briefly, HEK 293T cells were transiently transfected using the calcium phosphate method. After incubation for 24 h, cells were washed twice and lysed in a 1% Triton X-100 lysis buffer (20 mM Tris-HCl, pH 7.5; 1% Triton X-100; 50 mM NaCl; 50 mM NaF; 15 mM Na4P2O7; 0.1 mM EDTA; 2 mM Na3VO4; and protease inhibitors). After centrifugation at 15,000 x g (15 min, 4°C) and ultracentrifugation at 100,000 x g (30 min, 4°C), cell lysates containing equal amounts of total protein were precleared with protein G-sepharose and then incubated for 1 h at 4°C with the appropriate antibody, followed by incubation with 30 µl of protein G-sepharose beads for approximately 3 h. The beads were washed extensively with lysis buffer, and bound proteins were resolved by 10% SDS-PAGE. For endogenous interaction, eight mouse kidneys were homogenized using a glass potter, cleared by centrifugation, and solubilized in lysis buffer supplemented with 20 mM CHAPS and 3 mM ATP. Before immunoprecipitation, cellular lysates were further precleared by ultracentrifugation and absorption to protein G beads. All kidneys were freshly prepared and perfused in situ with ice-cold phosphate-buffered saline before lysis. Control samples were either incubated with a nonspecific rabbit antiserum before immunoprecipitation or with protein G beads alone.

Pull-Down Experiments
For pull-down experiments HEK 293T cells were transiently transfected, harvested, and lysed as described above. Lysates were precleared and incubated with the recombinant protein (10 µg) for 2 h at 4°C followed by incubation with 30 µl of protein G-sepharose beads for approximately 3 h. As in coimmunoprecipitations, the beads were washed with lysis buffer, and bound proteins were resolved by 10% SDS-PAGE.

Glycosylation Assays
HEK 293T transiently overexpressing NEPH1.ec.Fc were harvested, washed, and lysed as described above. The fusion protein was immobilized from lysates using G-sepharose beads. For each reaction, 30 µl of immobilized protein were added to 10 µl of 5x assay buffer (250 mM NaHPO4, pH 7.5) and 2.5 µl of denaturation buffer (2% SDS, 1 M {beta}-mercaptoethanol) followed by incubation at 95°C for 5 min. After cooling down, 2.5 µl of Triton-X100 were added to each tube together with 2 µl N-glycosidase F (PNGase F, Calbiochem, Bad Soden, Germany) for the test samples, and 2 µl H2O for the controls. After incubation at 37°C for five hours, deglycosylation was verified by monitoring the size-shift on a 10% SDS-PAGE.

Immunohistochemisty
Frozen mouse kidneys were embedded in OCT, cut into 5-µm sections, and fixed with ice-cold acetone for 2 min before staining. The blocking solution was 10 mM TRIS-HCl (pH 7.4), 100 mM MgCl2, 0.5% Tween 20, 1% bovine serum albumin, and 5% fetal calf serum, the washing buffer was PBS containing 0.04% Triton-X100 and 0.35% DMSO. All incubations were performed in a moist chamber at room temperature. For indirect immunoperoxidase stainings, we used the Vectastain ABC kit (Vector Laboratories, Burlingame, CA) following the manufacturers’ protocol. Endogenous peroxidase activity was quenched with 0.3% H2O2 for 30 min.

Fusion protein staining was performed by incubating cryosections with NEPH1.ec.Fc at 20 µg/ml for 1 h, followed by incubation with FITC-goat anti human (ICN). Controls were incubated with identical concentrations of human IgG. For paraffin sections, tissues were fixed with methanol/DMSO (4:1 vol/vol) at 4°C over night, dehydrated, paraffin-wax embedded, cut into 5-µm sections, mounted on Super Frost Plus slides (Menzel, Braunschweig, Germany), dewaxed, and rehydrated. For all NEPH1 stainings, the antiserum was diluted 1:10. To improve antibody penetration and antigen recognition, paraffin sections were boiled in 10 mM citric acid for 5 min. An Axiophot 2 microscope (Zeiss, Jena, Germany) equipped with a CCD camera was used for image documentation.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Ligand of NEPH1 Co-Localizes to the Glomerular Capillary Wall
To characterize the ligand of NEPH1, we generated Ig fusion proteins that contained the extracellular domain or single Ig domains of NEPH1 and nephrin fused to the CH2 and CH3 domain of human IgG (Figure 1). To ensure correct glycosylation of the NEPH1 fusion protein containing the entire extracellular domain of NEPH1 (NEPH1-ec.Fc), the fusion protein was affinity-purified from retrovirally transformed COS M6 cells or transiently transfected HEK 293T cells (Figure 2). Frozen sections of mouse kidneys were incubated with NEPH1.ec.Fc or an identical concentration of human IgG. As shown in Figure 3, the NEPH1 fusion protein, but not human IgG, specifically outlined the glomerular capillary wall, using immunohistochemistry or indirect immunofluorescence. The NEPH1 fusion protein labeled the mouse glomerulus in a staining pattern identical to NEPH1; we therefore speculated that the NEPH1 fusion protein binds to NEPH1 at the glomerular slit diaphragm.



View larger version (17K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 1. Generation of nephrin and NEPH1 fusion proteins. The Ig and fibroncectin (FN)-like domains were predicted using the SMART prediction program (http://smart.EMBL-Heidelberg.de/). All constructs containing the amino-terminal domains of either NEPH1 or nephrin include the authentic signal peptide (SP). The carboxy-terminal Ig domains were fused to the carboxy-terminus of the CH2 and CH3 domain of human IgG. To target these constructs to the secretory pathway, the fusion proteins were preceded by the leader sequence of CD5 (black box) (10,11 ). The constructs Nephrin.ec.Fc and NEPH1.ec.Fc contain the entire extracellular (ec) domain of either nephrin or NEPH1.

 


View larger version (20K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 2. Expression of nephrin and NEPH1 fusion proteins. (A) Expression of NEPH1 and control fusion proteins in HEK 293T cells. Lysates were prepared after 24 h of incubation and separated on SDS-PAGE. Western blot analyses were performed with a HRP-coupled antiserum directed against human IgG. The control protein sFc.7, a fusion protein containing the CH2 and CH3 domain of human IgG, is extremely well expressed, typically resulting in a smear. (B) Expression of nephrin and control fusion proteins in HEK 293T cells. Lysates were prepared after 24 h of incubation and separated on SDS-PAGE. Western blot analyses were performed with an HRP-coupled antiserum directed against human IgG.

 


View larger version (91K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 3. Glomerular localization of NEPH1 and the ligand of NEPH1. (A and B) Glomerular distribution of NEPH1 in the mouse kidney at 4 wk of age by immunohistochemistry. The anti-NEPH1 antiserum outlines the glomerular basement membrane in a pattern similar to the reported distribution of nephrin and podocin. The control rabbit antiserum reveals no significant staining of mouse renal tissue. (C and D) Glomerular distribution of NEPH1 in the mouse kidney at 4 wk of age by immunofluorescence. The anti-NEPH1 antiserum outlines the glomerular basement membrane, while the control rabbit antiserum reveals very little background staining. (E and F) Glomerular distribution of the putative ligand of NEPH1. Frozen sections of the mouse kidney were incubated with affinity-purified NEPH1.ec.Fc (E) or human IgG (F) at a concentration of 20 µg/ml. Both sections were subsequently labeled with a FITC-conjugated secondary antibody directed against human IgG. The NEPH1.ec.Fc, but not the control serum, revealed a highly specific labeling of the glomerular basement membrane in a staining pattern identical to the staining pattern obtained for the anti-NEPH1 antiserum (C).

 
NEPH1 Forms Homodimers
Using wild-type NEPH1 in combination with either NEPH1.ec.Fc or Flag-tagged NEPH1, we tested whether constructs containing the extracellular domain of NEPH1 can precipitate full-length NEPH1 from transiently transfected HEK 293T cells. We used two control proteins, sFc.7, a fusion protein containing the CH2 and CH3 domains of human IgG (10,11 ), and PKD.Fc, a fusion protein containing amino acid 1 to 480 of the N-terminal domain of polycystin-1 (13), including the first PKD repeat, and the CH2 and CH3 domain of human IgG. PKD repeats are Ig-like domains present in the extracellular domain of polycystin-1 (13) and mediate homodimeric interactions (6). While the NEPH1-Ig fusion protein (NEPH1.ec.Fc) precipitated full-length NEPH1, both control proteins failed to immobilize NEPH1 using identical detergent and washing conditions (Figure 4).



View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 4. Homodimeric and heterodimeric interactions of NEPH1. (A) The NEPH1 fusion proteins precipitate NEPH1. The NEPH1 fusion proteins, containing either the entire extracellular domain of NEPH1 (NEPH1.ec.Fc) or truncations of the extracellular domain of NEPH1, were co-expressed with the Flag-tagged version of NEPH1 (NEPH1.F) in transiently transfected HEK 293T cells. Cellular lysates were incubated with protein G to precipitate the NEPH1 fusion proteins. NEPH1.F, bound to NEPH1.ec.Fc, was detected by Western blot analysis, using the M2 anti-Flag monoclonal antibody. All three NEPH1 fusion proteins, NEPH1.ec.Fc, containing the entire extracellular domain of NEPH1, NEPH1.Ig1+2.Fc, containing the N-terminal three Ig domains of NEPH1, and sFc.NEPH1.Ig3+4, containing the third and fourth Ig domain, precipitated Flag-tagged NEPH1. In contrast, both control proteins, sFc.7 and PKD. Fc, failed to immobilize NEPH1.F. (B) The NEPH1 fusion proteins precipitate nephrin. The NEPH1 fusion proteins were co-expressed with Flag-tagged nephrin (Nephrin.F) in HEK 293T cells. Again, all NEPH1 fusion proteins precipitated Nephrin.F, whereas the two control proteins failed to interact with nephrin. (C) Nephrin fusion proteins precipitate NEPH1. Nephrin fusion proteins were generated to test the NEPH1-nephrin interaction after immobilization of nephrin. Co-expression of Nephrin.ec.Fc, containing the entire extracellular domain of nephrin, or fusion proteins, containing individual nephrin Ig domains as indicated, immunoprecipitated the Flag-tagged NEPH1. Both control proteins failed to precipitate NEPH1, although the NEPH1 expression was higher in the controls than in the presence of the nephrin fusion proteins. (D) Interaction between NEPH1 and nephrin in vivo. Lysates prepared from mouse kidneys were incubated with anti-nephrin antiserum and subsequently precipitated with protein G. Immobilized NEPH1 was detected by Western blot analyses, using a NEPH1-specific antiserum, indicating that at least a small fraction of nephrin and NEPH1 appears to interact in vivo (upper panel). Addition of ATP to the lysis buffer appeared to increase the amount of immobilized NEPH1 (lower panel).

 
The Adhesive Properties of NEPH1 Are Not Confined to a Single Ig Domain of NEPH1
In several cell surface receptors of the Ig superfamily, the ligand binding area can be mapped to a linear motif, often located at the N-terminus of the molecule. To test whether the N-terminal two Ig domains mediate the NEPH1-NEPH1 interaction, we generated fusion proteins containing the two N- or two C-terminal Ig domains. These Ig domains were fused to the N- or the C-terminus of human CH2 and CH3. As shown in Figure 4A, both fusion proteins were sufficient to precipitate NEPH1, but a similarly constructed control protein failed to interact with NEPH1.F. These results suggest that the homodimerization of NEPH1 molecules is not mediated by a linear peptide motif, but most likely involves multiple contact sites along the entire extracellular domain of NEPH1.

NEPH1 Forms Heterodimers with Nephrin
The targeted deletion of either NEPH1 or nephrin in mice is characterized by heavy proteinuria and death in the early perinatal period. These almost identical phenotypes suggest that both molecules have similar or overlapping functions. We therefore tested whether NEPH1 and nephrin form physical interactions. As demonstrated in Figure 4B, the NEPH1-Ig fusion proteins precipitated nephrin containing a C-terminal Flag-tag. Furthermore, a nephrin-Ig fusion protein containing either the full-length or truncations of the extracellular domain of nephrin precipitated Flag-tagged NEPH1 (Figure 4C). These findings indicate that NEPH1 and nephrin can engage in heterodimeric interactions. However, the interaction is surprisingly promiscuous, involving different Ig domains of both molecules. Nevertheless, immunoprecipitation of nephrin from mouse kidneys with anti-nephrin antiserum, but not with normal rabbit antiserum, precipitated a band at the predicted size of NEPH1, suggesting that the interaction between nephrin and NEPH1 is present in vivo (Figure 4D). This interaction was only detectable after solubilization of kidney lysates with 20 mM CHAPS, indicating that a substantial fraction of both proteins is associated with lipid rafts. Addition of 3 mM ATP to the lysis buffer appeared to increase the amount of NEPH1, precipitated with anti-nephrin antiserum versus protein G alone (Figure 4D, lower panel), indicating that association with both lipid rafts (14) and the cytoskeleton (15) reduces the solubility of NEPH1 and/or nephrin and limits the experimental approaches to verify this interaction in vivo.

Nephrin Forms Homodimers
It has been proposed that the electron-dense central region of the slit diaphragm is formed by interdigitating nephrin molecules that span the distance between two neighboring podocyte foot processes. Using coimmunoprecipitations of transiently transfected proteins, we tested whether the nephrin fusion protein immobilizes wild-type nephrin. As demonstrated in Figure 5, the nephrin-Ig fusions precipitated membrane-anchored, Flag-tagged nephrin. Again, this interaction was not confined to a specific Ig domain of nephrin. These findings confirm that the Ig domains of NEPH1 and nephrin form promiscuous homodimeric and heterodimeric interactions.



View larger version (15K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 5. Nephrin forms homodimers. HEK 293T cells were transiently transfected with Flag-tagged nephrin and the nephrin fusion proteins as indicated. The Nephrin.ec.Fc fusion contains the entire extracellular domain of nephrin fused to the CH2 and CH3 domain of human IgG, whereas the other fusion proteins contain the Ig domains 1 to 3, 3 and 4, 5 and 6, or 7 to 9 fused to either the N-terminus of CH2 (Fc fusions) or the C-terminus of CH3 (sFc fusions). Protein G was used to immobilize the fusion proteins, and Western blot analyses were performed to detect precipitated nephrin, utilizing the Flag-specific M2 monoclonal antibody. (A and B) Flag-tagged nephrin (Nephrin.F) interacts with nephrin fusion proteins that include either the entire extracellular domain of nephrin or fragments of the extracellular domain of nephrin. In contrast, the two control proteins, sFc.7 and PKD.Fc, did not interact with nephrin.

 
The Nephrin-NEPH1 Interaction Is Glycosylation-Dependent
PNGase F treatment of immunoprecipitated NEPH1 significantly decreased the molecular weight of NEPH1, revealing that NEPH1 is heavily glycosylated (Figure 6A). Correct folding of the extracellular domain of surface proteins and interaction with ligands or other surface proteins commonly requires adequate glycosylation. We therefore suspected that NEPH1 expressed in eukaryotic cells, but not bacterially expressed NEPH1, can precipitate Flag-tagged nephrin in pull-down experiments. Figure 6B demonstrates that purified NEPH1-ec.Fc immobilized with protein G retains Flag-tagged NEPH1, whereas MBP-NEPH1, a maltose-binding protein fusion with NEPH1 generated in Escherichia coli, failed to immobilize either nephrin or NEPH1. Furthermore, purified NEPH1-ec.Fc expressed in HEK 293T cells, failed to immobilize NEPH1 or nephrin after treatment with PNGase F (Figure 6, C and D). These findings demonstrate that the NEPH1-NEPH1 as well as the nephrin-NEPH1 interactions require correct glycosylation of NEPH1.



View larger version (15K):
[in this window]
[in a new window]
[as a PowerPoint slide]
 
Figure 6. The NEPH1-nephrin interactions require post-translational glycosylation. (A) NEPH1 is N-glycosylated. HEK 293T cells were transiently transfected with Flag-tagged NEPH1 and precipitated with the Flag-specific M2 monoclonal antibody. Treatment with PNGase F resulted in a significant decrease of the molecular weight of NEPH1, confirming that this molecule is heavily glycosylated. (B) The extracellular domain of NEPH1, expressed in HEK 293T cells (NEPH1.ec.Fc), but not recombinant NEPH1, expressed as a maltose-binding protein fusion (MBP) in Escherichia coli (MBP.NEPH1.ec) interacts with nephrin or NEPH1. Cellular lysates of HEK 293T cells, expressing either Flag-tagged nephrin or NEPH1, were incubated with the control protein sFc.7, NEPH1.ec.Fc or MBP.NEPH1.ec, immobilized to either protein G or amylose resin. NEPH1.F only interacted with NEPH1.ec.Fc, but not with either the control protein, or the recombinant MBP fusion protein. (C and D) PNGase F treatment abolished the interaction of NEPH1 and nephrin with the NEPH1 fusion protein. The NEPH1.ec.Fc was immobilized to protein G and treated with PNGase F or buffer, lacking the enzyme. PNGase F-treated NEPH1.ec.Fc failed to precipitate either Flag-tagged nephrin (Nephrin.F) or NEPH1 (NEPH1.F), expressed in HEK 293T cells.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several proteins, altered in hereditary nephrotic syndromes or experimental proteinuria, localize to the glomerular slit diaphragm. This structure, formed between interdigitating podocytes, together with the glomerular basement membrane and the endothelial cell layer is a filtration barrier for proteins of higher molecular weights. On the basis of electron micrographs of tannic acid-stained and glutaraldehyde-fixed rat glomerular, Rodewald and Karnovsky (16) suggested that the slit diaphragm is formed by a zipper-like organization of integral membrane proteins. The domain architecture of nephrin prompted Ruotsalainen et al. (3) to speculate that nephrin contributes to the formation of this zipper-like structure through homophilic interactions, typcial for several cell surface molecules of the Ig superfamily (17,18 ). A head-to-head assembly of nephrin was suggested, postulating that the N-terminal six Ig domains of opposing nephrin molecules form interdigitating assemblies. The average length of the nephrin Ig domains was estimated at 35Å; therefore, the eight Ig domains together with the fibronectin type III domain and spacer regions of nephrin could bridge most of the estimated 35- to 45-nm width of the slit diaphragm (3). Our results presented here provide the first evidence that nephrin forms homodimers. Yet, the self-association of nephrin Ig domains was far more promiscuous than anticipated. All tested combinations of Ig domains precipitated full-length nephrin and appear to contribute to the homodimerization of nephrin molecules. Interestingly, there are several cell adhesion molecules (CAM) of the Ig superfamily that display similar properties (reviewed in references 17 and 18). For example, members of the L1 family of CAM involved in axonal growth and path finding form homodimers and heterodimers involving several Ig domain. Furthermore, several CAM that mediate neurite outgrowth, associate with lipid rafts, couple to Fyn, and activate canonical signaling cascades, thereby closely resembling some of the currently known properties of nephrin (10,19 ). Type II and desmosomal members of the cadherin protein superfamily share a similar domain architecture with NEPH1, containing five tandem extracellular cadherin domains (reviewed in reference 20). Again, several intermolecular interfaces and contact sites appear to form the zipper-like superstructure typical of these cell adhesion molecules (21,22 ).

Although NEPH1 coimmunoprecipitates nephrin, the NEPH1 fusion protein immobilized on plastic surfaces, failed to bind NEPH1/nephrin-transfected HEK 293T, or differentiated mouse podocytes retrovirally transduced to overexpress nephrin (data not shown). Therefore, additional factors may be required for NEPH1/nephrin to mediate the cell-cell adhesion reported for the related Drosophila proteins Hbs and Duf (8). It is important to note that several cell adhesion molecules of the Ig superfamily associate with the cytoskeleton, and their adhesive strength critically depends on this interaction (18,23 ). Thus, recruitment to lipid rafts and anchorage of NEPH1 or nephrin with the cytoskeleton may be mandatory for efficient homodimerization and heterodimerization. In addition, antiparallel trans interaction of dimers on opposing cells may require prior cis homodimerization or heterodimerization of NEPH1 and nephrin. Clearly, cis homodimerization is a mandatory step for subsequent trans interactions in C-cadherin-mediated cell contacts (24). It is interesting to note that the Ca2+-independent Ig-like cell-cell adhesion molecule nectin appears to utilize different Ig domains for different functions. While the N-terminal Ig domain is essential for trans-dimer formation, cis homodimerization, an essential step for subsequent trans homodimerization, is mediated by the second Ig domain of nectin (25).

Although immunoprecipitation of endogenous nephrin from mouse kidneys immobilized NEPH1, this finding has to be interpreted with caution. On the basis of the comparison with other Ig CAM, we anticipate that most of the NEPH1 and nephrin molecules engaged in homogenic and heterogenic interactions are associated with lipid rafts and/or the cytoskeleton and are thus detergent-resistant (15). It is therefore possible that the small amounts of immobilized NEPH1 result from a minor fraction of protein that has not been targeted to lipid rafts.

Although our findings confirm and extend some of the earlier speculations by Tryggvason (2,26,27 ), they also raise new questions. First, the interactions between NEPH1/nephrin molecules are surprisingly promiscuous and not confined to single Ig domains, suggesting that additional factors such as lipid raft recruitment and cytoskeletal anchorage may regulate the affinity and specificity of the NEPH1/nephrin interactions in vivo. Second, although homodimers and heterodimers of NEPH1 and nephrin are clearly detectable by immunoprecipitation, future work needs to demonstrate, whether these molecules can engage in trans interactions that are sufficient to mediate cell-cell adhesion.


    Acknowledgments
 
We thank L.B. Holzman for the generous gift of the anti-nephrin antiserum, O. Beltcheva and K. Tryggvason for helpful discussions, P. Stunz and B. Wehrle for expert technical assistance, and the members of the Walz laboratory for valuable suggestions. Some of our results were presented at the ASN meeting 2002 in Philadelphia, Pennsylvania. We acknowledge that similar findings were reported by L.B. Holzman’s laboratory at this meeting. This work was supported by DFG grant WA 597.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kestila M, Lenkkeri U, Mannikko M, Lamerdin J, McCready P, Putaala H, Ruotsalainen V, Morita T, Nissinen M, Herva R, Kashtan CE, Peltonen L, Holmberg C, Olsen A, Tryggvason K: Positionally cloned gene for a novel glomerular protein-nephrin-is mutated in congenital nephrotic syndrome. Mol Cell 1: 575–582, 1998[CrossRef][Medline]
  2. Tryggvason K, Wartiovaara J: Molecular basis of glomerular permselectivity. Curr Opin Nephrol Hypertens 10: 543–549, 2001[CrossRef][Medline]
  3. Ruotsalainen V, Ljungberg P, Wartiovaara J, Lenkkeri U, Kestila M, Jalanko H, Holmberg C, Tryggvason K: Nephrin is specifically located at the slit diaphragm of glomerular podocytes. Proc Natl Acad Sci USA 96: 7962–7967, 1999[Abstract/Free Full Text]
  4. Donoviel DB, Freed DD, Vogel H, Potter DG, Hawkins E, Barrish JP, Mathur BN, Turner CA, Geske R, Montgomery CA, Starbuck M, Brandt M, Gupta A, Ramirez-Solis R, Zambrowicz BP, Powell DR: Proteinuria and perinatal lethality in mice lacking NEPH1, a novel protein with homology to NEPHRIN. Mol Cell Biol 21: 4829–4836, 2001[Abstract/Free Full Text]
  5. Palombo GM, Kovari IA, Verma R, Sanden SK, Holzman LB: Identification of a Nephrin-Neph1 heterophilic interaction. J Am Soc Nephrol 13: 526A, 2002
  6. Ibraghimov-Beskrovnaya O, Bukanov NO, Donohue LC, Dackowski WR, Klinger KW, Landes GM: Strong homophilic interactions of the Ig-like domains of polycystin-1, the protein product of an autosomal dominant polycystic kidney disease gene, PKD1. Hum Mol Genet 9: 1641–1649, 2000[Abstract/Free Full Text]
  7. Putaala H, Soininen R, Kilpelainen P, Wartiovaara J, Tryggvason K: The murine nephrin gene is specifically expressed in kidney, brain and pancreas: Inactivation of the gene leads to massive proteinuria and neonatal death. Hum Mol Genet 10: 1–8, 2001[Abstract/Free Full Text]
  8. Dworak HA, Charles MA, Pellerano LB, Sink H: Characterization of Drosophila hibris, a gene related to human nephrin. Development 128: 4265–4276, 2001[Abstract/Free Full Text]
  9. Ruiz-Gomez M, Coutts N, Price A, Taylor MV, Bate M: Drosophila dumbfounded: A myoblast attractant essential for fusion. Cell 102: 189–198, 2000[CrossRef][Medline]
  10. Huber TB, Kottgen M, Schilling B, Walz G, Benzing T: Interaction with podocin facilitates nephrin signaling. J Biol Chem 276: 41543–41546, 2001[Abstract/Free Full Text]
  11. Sellin L, Huber TB, Gerke P, Quack I, Pavenstadt H, Walz G: NEPH1 defines a novel family of podocin-interacting proteins. FASEB J 1: 1, 2002
  12. Nickel C, Benzing T, Sellin L, Gerke P, Karihaloo A, Liu ZX, Cantley LG, Walz G: The polycystin-1 C-terminal fragment triggers branching morphogenesis and migration of tubular kidney epithelial cells. J Clin Invest 109: 481–489, 2002[CrossRef][Medline]
  13. Bycroft M, Bateman A, Clarke J, Hamill SJ, Sandford R, Thomas RL, Chothia C: The structure of a PKD domain from polycystin-1: Implications for polycystic kidney disease. Embo J 18: 297–305, 1999[CrossRef][Medline]
  14. Simons M, Schwarz K, Kriz W, Miettinen A, Reiser J, Mundel P, Holthofer H: Involvement of lipid rafts in nephrin phosphorylation and organization of the glomerular slit diaphragm. Am J Pathol 159: 1069–1077, 2001[Abstract/Free Full Text]
  15. Yuan H, Takeuchi E, Salant DJ: Podocyte slit-diaphragm protein nephrin is linked to the actin cytoskeleton. Am J Physiol Renal Physiol 282: F585–F591, 2002[Abstract/Free Full Text]
  16. Rodewald R, Karnovsky MJ: Porous substructure of the glomerular slit diaphragm in the rat and mouse. J Cell Biol 60: 423–433, 1974[Abstract/Free Full Text]
  17. Brummendorf T, Rathjen FG: Structure/function relationships of axon-associated adhesion receptors of the immunoglobulin superfamily. Curr Opin Neurobiol 6: 584–593, 1996[CrossRef][Medline]
  18. Kamiguchi H, Lemmon V: IgCAMs: Bidirectional signals underlying neurite growth. Curr Opin Cell Biol 12: 598–605, 2000[CrossRef][Medline]
  19. Schwarz K, Simons M, Reiser J, Saleem MA, Faul C, Kriz W, Shaw AS, Holzman LB, Mundel P: Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. J Clin Invest 108: 1621–1629, 2001[CrossRef][Medline]
  20. Yagi T, Takeichi M: Cadherin superfamily genes: Functions, genomic organization, and neurologic diversity. Genes Dev 14: 1169–1180, 2000[Free Full Text]
  21. Shapiro L, Fannon AM, Kwong PD, Thompson A, Lehmann MS, Grubel G, Legrand JF, Als-Nielsen J, Colman DR, Hendrickson WA: Structural basis of cell-cell adhesion by cadherins. Nature 374: 327–337, 1995[CrossRef][Medline]
  22. Nagar B, Overduin M, Ikura M, Rini JM: Structural basis of calcium-induced E-cadherin rigidification and dimerization. Nature 380: 360–364, 1996[CrossRef][Medline]
  23. Gumbiner BM: Regulation of cadherin adhesive activity. J Cell Biol 148: 399–404, 2000[Abstract/Free Full Text]
  24. Brieher WM, Yap AS, Gumbiner BM: Lateral dimerization is required for the homophilic binding activity of C-cadherin. J Cell Biol 135: 487–496, 1996[Abstract/Free Full Text]
  25. Momose Y, Honda T, Inagaki M, Shimizu K, Irie K, Nakanishi H, Takai Y: Role of the second immunoglobulin-like loop of nectin in cell-cell adhesion. Biochem Biophys Res Commun 293: 45–49, 2002[CrossRef][Medline]
  26. Tryggvason K: Unraveling the mechanisms of glomerular ultrafiltration: nephrin, a key component of the slit diaphragm. J Am Soc Nephrol 10: 2440–2445, 1999[Free Full Text]
  27. Tryggvason K, Ruotsalainen V, Wartiovaara J: Discovery of the congenital nephrotic syndrome gene discloses the structure of the mysterious molecular sieve of the kidney. Int J Dev Biol 43: 445–451, 1999[Medline]
Received for publication November 21, 2002. Accepted for publication January 4, 2003.




This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
A. Philippe, F. Nevo, E. L. Esquivel, D. Reklaityte, O. Gribouval, M.-J. Tete, C. Loirat, J. Dantal, M. Fischbach, C. Pouteil-Noble, et al.
Nephrin Mutations Can Cause Childhood-Onset Steroid-Resistant Nephrotic Syndrome
J. Am. Soc. Nephrol., October 1, 2008; 19(10): 1871 - 1878.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Hartleben, H. Schweizer, P. Lubben, M. P. Bartram, C. C. Moller, R. Herr, C. Wei, E. Neumann-Haefelin, B. Schermer, H. Zentgraf, et al.
Neph-Nephrin Proteins Bind the Par3-Par6-Atypical Protein Kinase C (aPKC) Complex to Regulate Podocyte Cell Polarity
J. Biol. Chem., August 22, 2008; 283(34): 23033 - 23038.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
F. Collino, B. Bussolati, E. Gerbaudo, L. Marozio, S. Pelissetto, C. Benedetto, and G. Camussi
Preeclamptic sera induce nephrin shedding from podocytes through endothelin-1 release by endothelial glomerular cells
Am J Physiol Renal Physiol, May 1, 2008; 294(5): F1185 - F1194.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Harita, H. Kurihara, H. Kosako, T. Tezuka, T. Sekine, T. Igarashi, and S. Hattori
Neph1, a Component of the Kidney Slit Diaphragm, Is Tyrosine-phosphorylated by the Src Family Tyrosine Kinase and Modulates Intracellular Signaling by Binding to Grb2
J. Biol. Chem., April 4, 2008; 283(14): 9177 - 9186.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Garg, R. Verma, D. Nihalani, D. B. Johnstone, and L. B. Holzman
Neph1 Cooperates with Nephrin To Transduce a Signal That Induces Actin Polymerization
Mol. Cell. Biol., December 15, 2007; 27(24): 8698 - 8712.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
H. Holthofer
Molecular architecture of the glomerular slit diaphragm: lessons learnt for a better understanding of disease pathogenesis
Nephrol. Dial. Transplant., August 1, 2007; 22(8): 2124 - 2128.
[Full Text] [PDF]


Home page
CJASNHome page
N. He, A. Zahirieh, Y. Mei, B. Lee, S. Senthilnathan, B. Wong, B. Mucha, F. Hildebrandt, D. E. Cole, D. Cattran, et al.
Recessive NPHS2 (Podocin) Mutations Are Rare in Adult-Onset Idiopathic Focal Segmental Glomerulosclerosis
Clin. J. Am. Soc. Nephrol., January 1, 2007; 2(1): 31 - 37.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Quack, L. C. Rump, P. Gerke, I. Walther, T. Vinke, O. Vonend, T. Grunwald, and L. Sellin
beta-Arrestin2 mediates nephrin endocytosis and impairs slit diaphragm integrity
PNAS, September 19, 2006; 103(38): 14110 - 14115.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
K. Tryggvason, J. Patrakka, and J. Wartiovaara
Hereditary proteinuria syndromes and mechanisms of proteinuria.
N. Engl. J. Med., March 30, 2006; 354(13): 1387 - 1401.
[Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. Ma, J. Du, S. Sours, and M. Ding
Store-Operated Ca2+ Channel in Renal Microcirculation and Glomeruli
Experimental Biology and Medicine, February 1, 2006; 231(2): 145 - 153.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
G. Walz
Slit or pore? A mutation of the ion channel TRPC6 causes FSGS
Nephrol. Dial. Transplant., September 1, 2005; 20(9): 1777 - 1779.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
P. Gerke, L. Sellin, O. Kretz, D. Petraschka, H. Zentgraf, T. Benzing, and G. Walz
NEPH2 Is Located at the Glomerular Slit Diaphragm, Interacts with Nephrin and Is Cleaved from Podocytes by Metalloproteinases
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1693 - 1702.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
K. Tryggvason and J. Wartiovaara
How Does the Kidney Filter Plasma?
Physiology, April 1, 2005; 20(2): 96 - 101.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. Reiser and P. Mundel
Danger Signaling by Glomerular Podocytes Defines a Novel Function of Inducible B7-1 in the Pathogenesis of Nephrotic Syndrome
J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2246 - 2248.
[Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S. Lehtonen, E. Lehtonen, K. Kudlicka, H. Holthofer, and M. G. Farquhar
Nephrin Forms a Complex with Adherens Junction Proteins and CASK in Podocytes and in Madin-Darby Canine Kidney Cells Expressing Nephrin
Am. J. Pathol., September 1, 2004; 165(3): 923 - 936.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
X. L. Liu, S. C. Done, K. Yan, P. Kilpelainen, T. Pikkarainen, and K. Tryggvason
Defective Trafficking of Nephrin Missense Mutants Rescued by a Chemical Chaperone
J. Am. Soc. Nephrol., July 1, 2004; 15(7): 1731 - 1738.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
T. Benzing
Signaling at the Slit Diaphragm
J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1382 - 1391.
[Full Text] [PDF]


Home page
Hum Mol GenetHome page
T. B. Huber, M. Simons, B. Hartleben, L. Sernetz, M. Schmidts, E. Gundlach, M. A. Saleem, G. Walz, and T. Benzing
Molecular basis of the functional podocin-nephrin complex: mutations in the NPHS2 gene disrupt nephrin targeting to lipid raft microdomains
Hum. Mol. Genet., December 15, 2003; 12(24): 3397 - 3405.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Khoshnoodi, K. Sigmundsson, L.-G. Ofverstedt, U. Skoglund, B. Obrink, J. Wartiovaara, and K. Tryggvason
Nephrin Promotes Cell-Cell Adhesion through Homophilic Interactions
Am. J. Pathol., December 1, 2003; 163(6): 2337 - 2346.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gerke, P.
Right arrow Articles by Walz, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gerke, P.
Right arrow Articles by Walz, G.


HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP