2007 JASN IMPACT FACTOR 7.111	HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP
advanced	CURRENT ISSUE	ARCHIVES	JASN Express	ONLINE SUBMISSION

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Furuichi, K. Articles by Yokoyama, H. Search for Related Content PubMed PubMed Citation Articles by Furuichi, K. Articles by Yokoyama, H.

Gene Therapy Expressing Amino-Terminal Truncated Monocyte Chemoattractant Protein-1 Prevents Renal Ischemia-Reperfusion Injury

Kengo Furuichi^*, Takashi Wada^*, Yasunori Iwata^*, Kiyoki Kitagawa^*, Ken-ichi Kobayashi^*, Hiroyuki Hashimoto^#, Yoshiro Ishiwata^#, Naohisa Tomosugi, Naofumi Mukaida^¶, Kouji Matsushima, Kensuke Egashira and Hitoshi Yokoyama^*

*Department of Gastroenterology and Nephrology, Graduate School of Medical Science, and Division of Blood Purification, ^¶Department of Molecular Oncology, Cancer Research Institute, Kanazawa University, Kanazawa, Japan; ^#Sanwa Kagaku Kenkyusho Co., Ltd., Inabe, Japan; Division of Nephrology, Department of Internal Medicine, Kanazawa Medical University, Uchinada, Japan; Department of Molecular Preventive Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan; and Department of Cardiovascular Medicine, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan.

Correspondence to Dr. Takashi Wada, Department of Gastroenterology and Nephrology and Division of Blood Purification, Kanazawa University, 13-1 Takara-machi, Kanazawa 920-8641, Japan. Phone: 81-76-265-2000 ext. 3462; Fax: 81-76-234-4250;

Abstract

ABSTRACT. Ischemia-reperfusion is closely associated with tissue damage in various organs, including kidney. Despite clinical investigations, useful therapy for renal ischemia-reperfusion injury is not available so far. This study evaluated therapeutic effects of gene therapy expressing an amino-terminal deletion mutant of MCP-1 called 7ND to inhibit monocyte chemoattractant protein (MCP)-1/CCR2 signaling in vivo on renal ischemia-reperfusion injury. 7ND gene was transferred into the femoral muscle of Balb/c mice. Renal artery and vein of the left kidney were occluded with a vascular clamp for 60 min. A large number of infiltrated cells were observed, as was marked acute tubular necrosis in outer medulla after renal ischemia-reperfusion injury in control mice, while these lesions were significantly decreased in 7ND gene-transfected mice. Macrophages in the interstitial region, most of which were CCR2-positive, were markedly decreased in 7ND gene-transfected mice after reperfusion. Although macrophages infiltrated around MCP-1-positive cells in control mice, the smaller number of F4/80-positive cells could infiltrate into the neighbor of MCP-1-positive cells in 7ND-treated mice. These results provide evidence that gene therapy by 7ND is potentially a powerful therapeutic approach to inhibit MCP-1/CCR2 signaling, resulting in rescue from renal ischemia-reperfusion injury. E-mail: twada@medf.m.kanazawa-u.ac.jp

Renal ischemia-reperfusion is inevitable in renal transplantation and frequently associated with major surgery, renal artery stenosis, hemorrhage, burn, crushing injury, or shock state by various reasons (1). Ischemia-reperfusion injury has great impact on renal survival. Despite decades of laboratory and clinical investigations and the advent of renal replacement therapy, the overall mortality rate for acute tubular necrosis has changed little. Moreover, the long-term graft function of renal transplantation is associated with the initial intensity of ischemia-reperfusion injury (2). With all the clinical importance of renal ischemia-reperfusion injury, specific therapy for the injury should be considered.

Monocyte chemoattractant protein (MCP)-1 (also termed as monocyte chemotactic and activating factor), a well-known member of CC chemokine family, plays key roles in infiltration and activation of macrophages and results in tissue destruction, including renal diseases (3–5 ). Conversely, recent studies revealed that CCR2 signaling is also involved in tissue destruction of renal diseases (5–8 ). We therefore hypothesized that such blockade of MCP-1/CCR2 signaling pathway would suppress MCP-1/CCR2-mediated inflammation and thereby improve the destruction of renal ischemia-reperfusion injury. To achieve this goal, we evaluated gene therapy with electroporation to block MCP-1/CCR2 signaling pathway in vivo using an amino-terminal truncated MCP-1 called 7ND, which has been shown to bind to CCR2 and subsequently block MCP-1-mediated monocyte chemotaxis in vitro (9). The novel findings of this study are that postnatal blockade of MCP-1/CCR2 signaling pathway using 7ND markedly prevented after renal ischemia-reperfusion. We thus suggest that MCP-1/CCR2 signaling may be the possible therapeutic target for ischemia-reperfusion injury.

Materials and Methods

Expression of 7ND
Human 7ND cDNA with an epitope tag FLAG (DYKDDDDK) in the carboxyl-terminal was constructed by recombinant PCR using a wild-type human MCP-1 cDNA (a gift of Dr. Teizo Yoshimura, NCI, Frederick, MD) as template and cloned into the BamHI(5') and Nod1(3') sites of the pcDNA3 expression vector plasmid (Invitrogen, Carlsbad, CA). The expression of 7ND with FLAG in skeletal muscle was detected by immunohistochemical method using anti-FLAG M2 antibody (Sigma-Aldrich, Munich, Germany) 4 h after reperfusion. FLAG-conjugated 7ND in the serum was detected using FLAG Western detection kit (Stratagene, La Jolla, CA). In brief, to determine 7ND in the serum, SDS-polyacrylamide gel electrophoresis was carried out using SDS-page gels and SDS running buffer, and then the protein bands from the gels were electroblotted onto nitrocellulose membranes. FLAG Western detection kit was used for detecting immunoreactivity. Moreover, we evaluated the serum levels of 7ND using a quantitative sandwich enzyme immunoassay for human MCP-1 (R&D Systems, Minneapolis, MN). This assay does not crossreact other chemokines, including murine MCP-1.

Animals and Transfection of 7ND Gene
Inbred male Balb/c mice, aged 8 wk, were obtained from Charles River, Japan Inc. (Atsugi, Kanagawa, Japan). Three groups of Balb/c mice were studied: the sham-operated group; the control group, which received an administration of 50 µl of empty plasmid (1 µg/µl); and the 7ND gene-transfected group, which received an administration of 50 µl of plasmid (1 µg/µl) containing the 7ND gene into the femoral muscle. To enhance expression, the animal received electroporation using an electric pulse generator ECM830 (BTX, San Diego, CA) at the injected site immediately after injection.

All procedures employed in the animal experiments complied with the standards set out in the Guideline for the Care and Use of Laboratory Animals in Takara-machi Campus of Kanazawa University.

Renal Ischemic Model
Seven days after gene delivery, the renal artery and vein of the left kidney were occluded for 60 min. Zero, 4, 24, or 48 h after reperfusion, renal tissues from five mice at each time point were removed for pathologic examination.

Tissue Preparation
One portion of the renal tissue was fixed in 10% buffered formalin followed by embedding in paraffin and staining with hematoxylin and eosin as well as periodic acid-Schiff (PAS) reagent. Two independent observers with no prior knowledge of the experimental design evaluated each tissue section. The number of interstitial infiltrated cells was counted in 20 randomly selected high-power fields (x400) of outer medulla. The observers scored with a previously described semiquantitative scale designed to evaluate the degree of tubular necrosis (10). Higher score represented severe damage (maximum score, 4): 0, normal kidney; 1, <5% involvement; 2, 5 to 25% involvement; 3, 25 to 75% involvement; 4, >75% involvement.

Immunohistochemical Studies
The other portion of fresh renal tissue of 24 h after reperfusion, embedded in OCT compound and snap-frozen, was cut at 6 µm. The presence of F4/80-positive macrophages, CCR2-positive cells, and MCP-1-positive cells was detected immunohistochemically by using rat anti-mouse F4/80 monoclonal antibody (clone: A3–1; BMA Biomedicals AG, Augst, Switzerland), goat anti-mouse CCR2 antibodies (sc-6228; Santa Cruz Biotechnology, Santa Cruz, CA), or rabbit anti-murine MCP-1 antibodies. Sections were first incubated with goat anti-mouse CCR2 antibodies overnight. After rinsing in PBS, the rat anti-mouse F4/80 antibody was added, and the sections incubated overnight. To evaluate the specificity of these antibodies, we stained tissue specimens with normal goat or rat IgG, respectively, and absorbed antibody with CCR2 protein. The CCR2 staining was visualized by incubating the sections for 120 min with FITC-conjugated donkey anti-goat IgG antibodies (1:200; Jackson Immunoresearch Laboratory, Inc., PA). After rinsing, the sections were incubated for 120 min with Cy3-conjugated donkey anti-rat IgG antibodies (1:200; Jackson Immunoresearch Laboratory, Inc.) to visualize F4/80. Adobe Photoshop was used for image handling, and the three-color channels were handled separately. The number of interstitial infiltrated F4/80-positive cells was counted in 20 randomly selected high-power fields (x400) of outer medulla. Moreover, to evaluate the relation between MCP-1 and F4/80-positive cells, we used a dual-labeled color immunofluorescence immunohistochemistry with rabbit anti-mouse MCP-1 antibodies and rat anti-mouse F4/80 antibodies. Briefly, Vectastain ABC-alkaline phosphatase kit (Vector Lab, Burlingame, CA) was used to detect MCP-1. Then, the slides were blocked by 0.1% sodium azide and 0.3% H₂O₂ in methanol for 15 min. After this process, the Vectastain ABC-peroxidase kit (Vector Lab) was used to detect F4/80. The specificity of rabbit anti-mouse MCP-1 antibodies was evaluated with normal rabbit IgG and absorbed antibody with MCP-1 protein.

Detection of MCP-1 Transcripts in Diseased Kidneys
To determine the MCP-1 transcripts, total RNA was extracted from the whole kidneys from five mice in each group 4 h after reperfusion. cDNA was reverse-transcriped from 5 µg of total RNA, combined from five mice in each group (1 µg of RNA per a mouse), by using a SuperScript II RNase H- Reverse Transcriptase (Invitrogen, Carlsbad, CA). Reverse transcription was performed using the following parameters: 10 min at 25°C, 30 min at 48°C, and 5 min at 95°C. For all PCR experiments, the LightCycler (Roche Diagnostics, Basel, Switzerland) was used. Subsequently, real-time PCR was performed in the LightCycler using the LightCycler-FastStart DNA Master SYBR Green I (Roche Diagnostics). Primers for MCP-1 (forward: 5'- ACTGAAGCCAGCTCTCTCTTCCTC -3', reverse: 5'- TTCCTTCTTGGGGTCAGCACAGAC -3') (11) and GAPDH (Nihon Gene Research Lab’s, Inc., Sendai, Japan), and 2 µl of the cDNA prepared above were used to detect MCP-1 and GAPDH. The reactions were incubated at 95°C for 10 min followed by 40 cycles of 15 s at 95°C, 10 s at 55°C, and 20 s at 72°C. MCP-1 mRNA expression in each sample were finally described after correction with GAPDH expression. The expression of MCP-1 and GAPDH in each sample was quantified in separate wells. No PCR products were detected in the real-time PCR procedure without reverse transcription, indicating that the contamination of genomic DNA was negligible. Gels of the PCR products after quantification of MCP-1 or GAPDH by real-time PCR showed a single band (270 and 230 bp, respectively) with the expected size (data not shown). Moreover, we evaluated the serum levels of murine MCP-1 using a quantitative sandwich enzyme immunoassay for murine MCP-1 (R&D Systems). This assay dose not crossreact other chemokines.

Statistical Analyses
The mean and SEM were calculated on all the parameters determined in this study. Statistical analyses were performed using Kruskal-Wallis test and ANOVA test. P < 0.05 was accepted as statistically significant.

Results

MCP-1 Expression 4 h after Ischemia-Reperfusion
We detected MCP-1-positive cells among tubular epithelial cells and interstitial infiltrated cells equivalently in the kidney of control mice and 7ND gene-transfected mice 4 h after reperfusion (data not shown). Moreover, the expression of MCP-1 mRNA in injured kidney was increased in both control mice and 7ND gene-transfected mice compared with sham-operated mice (MCP-1/GAPDH: sham, 92.3; wild, 315.6; 7ND, 758.3). Furthermore, serum levels of MCP-1 in diseased kidneys did not differ between control mice and 7ND gene-transfected mice 4 h after reperfusion (sham, 57.0 ± 21.0 pg/ml; wild, 201.0 ± 41.7 pg/ml; 7ND, 198.0 ± 12.3 pg/ml; n = 5, respectively). These results suggested that ischemia-reperfusion itself induced renal damage equally in control mice and 7ND gene-transfected mice 4 h after reperfusion.

Expression of 7ND
The number of fibers positive for 7ND was observed in the femoral muscle from the 7ND gene-transfected mice 4 h after reperfusion (Figure 1A). In contrast, a carboxyl-terminal FLAG epitope-tagged 7ND gene was not detected in the muscles from the control group (Figure 1B). Moreover, Western blot analysis of the serum for FLAG protein showed that FLAG epitope-tagged 7ND was efficiently secreted into the serum in 7ND gene-transfected mice (Figure 1C). Furthermore, serum levels of 7ND increased during the experiments (sham, not detectable; 4 h, 47.4 ± 4.3 pg/ml; 24 h, 36.0 ± 6.5 pg/ml; 48 h, 35.2 ± 4.0 pg/ml; n = 5, respectively)

View larger version (40K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. 7ND expression in femoral muscle. The expression of 7ND with FLAG in skeletal muscle, where gene transfer was performed with electroporation, was detected by immunohistochemical method. The number of fibers positive for 7ND was observed in the femoral muscle from the 7ND gene-transfected mice 4 h after reperfusion (arrows) (A). No such expression of FLAG-conjugated 7ND gene was detected in the muscles from control mice (B). FLAG-conjugated 7ND in serum was detected by Western blot analysis. Blots were detected in serum 4 and 48 h after reperfusion in 7ND gene-transfected mice (C). 7ND indicates 7ND gene-transfected mice. Magnification, x40.

View larger version (74K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. 7ND gene-transfected mice reduced cell infiltration and acute tubular necrosis. Histopathologic examination was performed using PAS-stained renal tissues. Huge number of infiltrated cells and tubular necrosis were mainly observed in outer medulla in left kidney of control mice 24 h (A) and 48 h (B) after reperfusion. In contrast, the number of infiltrated cells and tubular necrosis decreased in left kidney of 7ND gene-transfected mice 24 h (C) and 48 h (D) after reperfusion. Panel E indicates histologic features of sham-operated left kidney. The scores of acute tubular necrosis in 7ND gene-transfected mice were significantly lower than in those of control mice 24 and 48 h after reperfusion in outer medulla (F). The total number of interstitial infiltrated cells significantly decreased in 7ND gene-transfected mice 24 and 48 h after reperfusion (G). 7ND indicates 7ND gene-transfected mice. Values are mean ± SEM. Original magnification is x400.

View larger version (52K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. The number of F4/80-positive cells, most of which were CCR2-positive, decreased in 7ND gene-transfected mice. The number of F4/80-positive cells was counted in randomly selected high-power fields (x400) of outer medulla 4, 24, and 48 h after reperfusion or sham operation. The number of F4/80-positive cells significantly decreased in 7ND gene-transfected mice 24 and 48 h after ischemia-reperfusion (A). F4/80-positive cells were visualized with Cy3, and the CCR2 staining with FITC. F4/80- (B) and CCR2- (D) positive cells were detected in outer medulla of ischemia-reperfusion kidney 24 h after reperfusion. Most of interstitial infiltrated F4/80-positive cells were also positive CCR2 in injured kidneys (C). CCR2 immunoreactivity was not detected in sections incubated with normal goat IgG (E). F4/80-positive cells (brown: arrows) infiltrated around MCP-1-positive tubular epithelial cells (red) in control mice 24 h after reperfusion (F). However, the smaller number of F4/80-positive cells (brown: arrows) infiltrated around MCP-1-positive cell (red) in 7ND gene-transfected mice 24 h after reperfusion (G). 7ND indicates 7ND gene-transfected mice. Values are mean ± SEM. Original magnification is x400.

In this report, we have demonstrated that postnatal blockade of MCP-1/CCR2 signaling pathway by the intramuscular transfer of a mutant gene, 7ND, significantly reduced renal injury in ischemia-reperfusion, including acute tubular necrosis and interstitial cell infiltration. Concomitantly, macrophages, most of which were CCR2-positive, were greatly reduced by 7ND. Taken together, inhibition of MCP-1/CCR2 signaling pathway with 7ND gene is the profitable therapy for ischemia-reperfusion injury in kidney.

This study strongly indicates MCP-1/CCR2 signaling pathway as the therapeutic target in renal ischemia-reperfusion injury. We have now demonstrated that the number of interstitial infiltrated macrophages was markedly reduced in 7ND gene-transfected mice. MCP-1 is one of the most vigorous chemotactic factors for macrophages, and CCR2 is the prominent cognate receptor for MCP-1. We demonstrated that most of infiltrated macrophages in injured kidney were CCR2-positive. In addition to chemotaxis, MCP-1 also engages the expression of adhesion molecules, resulting in extravasation of macrophages into the parenchyma of injured kidney (18). Furthermore, MCP-1 has been documented to induce release of lysozomal enzymes and generation of superoxide anions from macrophages, resulting in tissue destruction (19). Concomitantly, CCR2-deficient mice failed to recruit macrophages in several disease models (7,8,20 ). These data suggested the critical contribution of CCR2 in macrophage activation as well as recruitment into diseased organs, leading to tissue damage. Taken all together, MCP-1/CCR2 signaling pathway is important for ischemia-reperfusion injury, and its inhibition may be effective to quench renal injury possibly via diminution of macrophage infiltration and activation.

This study revealed the therapeutic potency of 7ND gene transfer in ischemia-reperfusion injury. It was recently reported that amino-terminal truncated chemokines, such as regulated upon activation, normal T cell expression and secreted (RANTES) and MCP-3, still bind their respective receptors without inducing the biologic response, and are thus true competitive receptor antagonists (21). Moreover, amino-terminus of MCP-1 is essential for MCP-1 to keep chemoattractant activity (22). Furthermore, it was reported that 7ND forms inactive heterodimer formation with wild-type MCP-1 and inhibits monocyte chemotaxis in vitro (9,21 ). On the basis of these, 7ND gene transfer protects the formation of arteriosclerosis and coronary vascular remodeling thus far (23,24 ). Therefore, 7ND gene transfer may effectively block MCP-1/CCR2 signaling pathway and prevent progression of MCP-1/CCR2–related diseases. No apparent side effects were observed during period of this study; however, careful observation over a long period of time will be needed in future studies.

This study revealed that the number of neutrophils was reduced in 7ND-treated mice. We and other researchers previously reported the importance of neutrophils in ischemia-reperfusion injury (25,26 ). A recent study revealed that inflammation upregulates CCR2 expression in neutrophils (12). Moreover, several studies reported that MCP-1 and CCR2 promote the chemotaxis of neutrophils during acute (13) and chronic (14,15 ) inflammatory conditions in vivo. Because CXC chemokines, which participate in infiltration of neutrophils (16) are reported to be secreted by monocytes, diminished the number of infiltrated monocytes and the blockade of activation of monocytes with 7ND may reduce CXC chemokine expression. Furthermore, activated neutrophils are a potential source of reactive oxygen species and proteolytic enzymes such as serine-proteases, metalloproteases, thiol-proteases, and aspartate proteases, resulting in tissue destruction (17). Collectively, 7ND gene transfer may participate in neutrophil infiltration, resulting in tubular necrosis in early phase of ischemia-reperfusion injury in mice.

Even though so many experiments and arguments on anti-MCP-1 therapy against inflammation have been discussed, specific and effective therapy against ischemia-reperfusion injury is not available so far. MCP-1 has been proved to be involved not only in ischemia-reperfusion injury but also in various types of inflammation using MCP-1 itself or CCR2-deficient mice (7,8,13,27 ). Therefore, regulation of MCP-1/CCR2 signaling leading to macrophage infiltration and activation may have therapeutic potential in inflammation, including renal injury. Thus, 7ND will be an appealing therapeutic approach of great efficacy and efficiency to ischemia-reperfusion injury in kidneys.

Acknowledgments

We thank Dr. Mariko Akiyama (Kanazawa University), Dr. Hui Wang (Kanazawa University), Dr. Toshikazu Kondo (Kanazawa University), and Dr. Chu Kataoka (Kyushu University) for excellent technical advice. TW is a recipient of a Grant-in-Aid (No. 14571019) from the Ministry of Education, Science, Sports and Culture of Japan.

References

1. Grace PA: Ischemia-reperfusion injury. Br J Surg 81: 637–647, 1994[Medline]
2. Shiskes DA, Halloran PD: Delayed graft function in renal transplantation: etiology, management and long-term significance. J Urol 155: 1831–1840, 1996[CrossRef][Medline]
3. Matsushima K, Larrsen CG, DuBois GC, Oppenheim JJ: Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J Exp Med 169: 1485–1490, 1989[Abstract/Free Full Text]
4. Yoshimura T, Robinson EA, Tanaka S, Appella E, Leonard EJ: Purification and amino acid analysis of two human monocyte chemoattractants produced by phytohemagglutinin-stimulated human blood mononuclear cell. J Immunol 142: 1956–1962, 1989[Abstract]
5. Segerer S, Nelson PJ, Schlondorff D: Chemokines, chemokine receptors, and renal disease: From basic science to pathophysiologic and therapeutic studies. J Am Soc Nephrol 11: 152–176, 2000[Abstract/Free Full Text]
6. Vielhauer V, Anders HJ, Mack M, Cihak J, Strutz F, Stangassinger, M., Luckow B, Grone HJ, Schlondorff D: Obstructive nephropathy in the mouse: Progressive fibrosis correlates with tubulointerstitial chemokine expression and accumulation of CC chemokine receptor 2- and 5-positive leukocytes. J Am Soc Nephrol 12: 1173–1187, 2001[Abstract/Free Full Text]
7. Kuziel WA, Morgan SJ, Dawson TC, Griffin S, Smithies O, Ley K, Maeda N: Severe reduction in leukocyte adhesion and monocyte extravasation in mice deficient in CC chemokine receptor 2. Proc Natl Acad Sci USA 94: 12053–12058, 1997[Abstract/Free Full Text]
8. Kurihara T, Warr G, Loy J, Bravo R: Defects in macrophage recruitment and host defense in mice lacking the CCR2 chemokine receptor. J Exp Med 186: 1757–1762, 1997[Abstract/Free Full Text]
9. Zhang Y, Rollins BJ: A dominant negative inhibitor indicates that monocyte chemoattractant protein 1 functions as a dimer. Mol Cell Biol 15: 4851–4855, 1995[Abstract]
10. Haq M, Norman J, Saba SR, Ramirez G, Rabb H: Role of IL-1 in renal ischemic reperfusion injury. J Am Soc Nephrol 9: 614–619, 1998[Abstract]
11. Ajuebor MN, Gibbs L, Flower RJ, Das AM, Perretti M: Investigation of the functional role played by the chemokine monocyte chemoattractant protein-1 in interleukin-1-induced murine peritonitis. Br J Pharmacol 125: 319–326, 1998[CrossRef][Medline]
12. Johnston B, Burns AR, Suematsu M, Issekutz TB, Woodman RC, Kubes P: Chronic inflammation upregulates chemokine receptors and induces neutrophil migration to monocyte chemoattractant protein-1. J Clin Invest 103: 1269–1276, 1999[Medline]
13. Tessier PA, Cattaruzzi P, McColl SR: Inhibition of lymphocyte adhesion to cytokine-activated synovial fibroblasts by glucocorticoids involves the attenuation of vascular cell adhesion molecule 1 and intercellular adhesion molecule 1 gene expression. Arthritis Rheum 39: 226–234, 1996[Medline]
14. Johnston B, Burns AR, Suematsu M, Issekutz TB, Woodman RC, Kubes P: Chronic inflammation upregulates chemokine receptors and induces neutrophil migration to monocyte chemoattractant protein-1. J Clin Invest 103: 1269–1276, 1999
15. Blease K, Mehrad B, Standiford TJ, Lukacs NW, Gosling J, Boring L, Charo IF, Kunkel SL, Hogaboam CM: Enhanced pulmonary allergic responses to Aspergillus in CCR2-/- mice. J Immunol 165: 2603–2611, 2000[Abstract/Free Full Text]
16. Zhang XW, Wang Y, Liu Q, Thorlacius H: Redundant function of macrophage inflammatory protein-2 and KC in tumor necrosis factor-alpha-induced extravasation of neutrophils in vivo. Eur J Pharmacol 427: 277–283, 2001[CrossRef][Medline]
17. Witko-Sarsat V, Rieu P, Descamps-Latscha B, Lesavre P, Halbwachs-Mecarelli L: Neutrophils: Molecules, functions and pathophysiological aspects. Lab Invest 80: 617–653, 2000[Medline]
18. Takada M, Nadeau KC, Shaw GD, Marquette KA, Tilney NL: The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat kidney. J Clin Invest 99: 2682–2690, 1997[Medline]
19. Baggiolini M, Dewald B, Moser B: Interleukin-8 and related chemotactic cytokiens-CXC and CC chemokines. Adv Immunol 55: 97–179, 1994[Medline]
20. Lu B, Rutledge BJ, Gu L, Fiorillo J, Lukacs NW, Kunkel SL, North R, Gerard C, Rollins BJ: Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice. J Exp Med 187: 601–608, 1998[Abstract/Free Full Text]
21. Gong JH, Uguccioni M, Dewald B, Baggiolini M, Clark-Lewis I: RANTES and MCP-3 antagonists bind multiple chemokine receptors. J Biol Chem 271: 10521–10527, 1996[Abstract/Free Full Text]
22. Gong JH, Clark-Lewis I: Antagonists of monocyte chemoattractant protein 1 identified by modification of functionally critical NH2-terminal residues. J Exp Med 181: 631–640, 1995[Abstract/Free Full Text]
23. Ni W, Egashira K, Kitamoto S, Kataoka C, Koyanagi M, Inoue S, Imaizumi K, Akiyama C, Nishida, Ki K, Takeshita A: New anti-monocyte chemoattractant protein-1 gene therapy attenuates atherosclerosis in apolipoprotein E-knockout mice. Circulation 103: 2096–2101, 2001[Abstract/Free Full Text]
24. Egashira K, Koyanagi M, Kitamoto S, Ni W, Kataoka C, Morishita R, Kaneda Y, Akiyama C, Nishida KI, Sueishi K, Takeshita A: Anti-monocyte chemoattractant protein-1 gene therapy inhibits vascular remodeling in rats: Blockade of MCP-1 activity after intramuscular transfer of a mutant gene inhibits vascular remodeling induced by chronic blockade of NO synthesis. FASEB J 14: 1974–1978, 2000[Abstract/Free Full Text]
25. Furuichi K, Wada T, Iwata Y, Sakai N, Yoshimoto K, Kobayashi K, Mukaida N, Matsushima K, Yokoyama H: Administration of FR167653, a new anti-inflammatory compound, prevents renal ischaemia/reperfusion injury in mice. Nephrol Dial Transplant 17: 399–407, 2002[Abstract/Free Full Text]
26. De Greef KE, Ysebaert DK, Ghielli M, Vercauteren S, Nouwen EJ, Eyskens EJ, De Broe ME: Neutrophils and acute ischemia-reperfusion injury. J Nephrol 11: 110–122, 1998[Medline]
27. Kim JS, Gautam SC, Chopp M, Zaloga C, Jones ML, Ward PA, Welch KM: Expression of monocyte chemoattractant protein-1 and macrophage inflammatory protein-1 after focal cerebral ischemia in the rat. J Neuroimmunol 56: 127–134, 1995[CrossRef][Medline]

This article has been cited by other articles:

				K. Furuichi, J.-L. Gao, R. Horuk, T. Wada, S. Kaneko, and P. M. Murphy Chemokine Receptor CCR1 Regulates Inflammatory Cell Infiltration after Renal Ischemia-Reperfusion Injury J. Immunol., December 15, 2008; 181(12): 8670 - 8676. [Abstract] [Full Text] [PDF]

				A. Kamijo-Ikemori, T. Sugaya, A. Sekizuka, K. Hirata, and K. Kimura Amelioration of diabetic tubulointerstitial damage in liver-type fatty acid binding protein transgenic mice Nephrol. Dial. Transplant., October 14, 2008; (2008) gfn573v1. [Abstract] [Full Text] [PDF]

				J. Park, D.-R. Ryu, J. J. Li, D.-S. Jung, S.-J. Kwak, S. H. Lee, T.-H. Yoo, S. H. Han, J. E. Lee, D. K. Kim, et al. MCP-1/CCR2 system is involved in high glucose-induced fibronectin and type IV collagen expression in cultured mesangial cells Am J Physiol Renal Physiol, September 1, 2008; 295(3): F749 - F757. [Abstract] [Full Text] [PDF]

				B. Zhang, G. Ramesh, S. Uematsu, S. Akira, and W. B. Reeves TLR4 Signaling Mediates Inflammation and Tissue Injury in Nephrotoxicity J. Am. Soc. Nephrol., May 1, 2008; 19(5): 923 - 932. [Abstract] [Full Text] [PDF]

				G. H. Tesch MCP-1/CCL2: a new diagnostic marker and therapeutic target for progressive renal injury in diabetic nephropathy Am J Physiol Renal Physiol, April 1, 2008; 294(4): F697 - F701. [Abstract] [Full Text] [PDF]

				L. H. Lu, D.-J. Oh, B. Dursun, Z. He, T. S. Hoke, S. Faubel, and C. L. Edelstein Increased Macrophage Infiltration and Fractalkine Expression in Cisplatin-Induced Acute Renal Failure in Mice J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 111 - 117. [Abstract] [Full Text] [PDF]

				D.-J. Oh, B. Dursun, Z. He, L. Lu, T. S. Hoke, D. Ljubanovic, S. Faubel, and C. L. Edelstein Fractalkine receptor (CX3CR1) inhibition is protective against ischemic acute renal failure in mice Am J Physiol Renal Physiol, January 1, 2008; 294(1): F264 - F271. [Abstract] [Full Text] [PDF]

				R. Yin, J. Zhu, Z. Wang, H. Huang, J. Qian, Z. Li, and H. Jing Simvastatin attenuates cardiac isograft ischemia-reperfusion injury by down-regulating CC chemokine receptor-2 expression J. Thorac. Cardiovasc. Surg., September 1, 2007; 134(3): 780 - 788. [Abstract] [Full Text] [PDF]

				J. W.A.M. Celie, N. W.P. Rutjes, E. D. Keuning, R. Soininen, R. Heljasvaara, T. Pihlajaniemi, A. M. Drager, S. Zweegman, F. L. Kessler, R. H.J. Beelen, et al. Subendothelial Heparan Sulfate Proteoglycans Become Major L-Selectin and Monocyte Chemoattractant Protein-1 Ligands upon Renal Ischemia/Reperfusion Am. J. Pathol., June 1, 2007; 170(6): 1865 - 1878. [Abstract] [Full Text] [PDF]

				A. Kamijo-Ikemori, T. Sugaya, A. Obama, J. Hiroi, H. Miura, M. Watanabe, T. Kumai, R. Ohtani-Kaneko, K. Hirata, and K. Kimura Liver-Type Fatty Acid-Binding Protein Attenuates Renal Injury Induced by Unilateral Ureteral Obstruction Am. J. Pathol., October 1, 2006; 169(4): 1107 - 1117. [Abstract] [Full Text] [PDF]

				G. Zheng, Y. Wang, S.-H. Xiang, Y.-C. Tay, H. Wu, D. Watson, J. Coombes, G. K. Rangan, S. I. Alexander, and D. C.H. Harris DNA Vaccination with CCL2 DNA Modified by the Addition of an Adjuvant Epitope Protects against "Nonimmune" Toxic Renal Injury J. Am. Soc. Nephrol., February 1, 2006; 17(2): 465 - 474. [Abstract] [Full Text] [PDF]

				M. L. Kielar, R. John, M. Bennett, J. A. Richardson, J. M. Shelton, L. Chen, D. R. Jeyarajah, X. J. Zhou, H. Zhou, B. Chiquett, et al. Maladaptive Role of IL-6 in Ischemic Acute Renal Failure J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3315 - 3325. [Abstract] [Full Text] [PDF]

				H.-J. Anders, V. Vielhauer, and D. Schlondorff Current paradigms about chemokines as therapeutic targets Nephrol. Dial. Transplant., December 1, 2004; 19(12): 2948 - 2951. [Full Text] [PDF]

				S. Shimizu, H. Nakashima, K. Masutani, Y. Inoue, K. Miyake, M. Akahoshi, Y. Tanaka, K. Egashira, H. Hirakata, T. Otsuka, et al. Anti-monocyte chemoattractant protein-1 gene therapy attenuates nephritis in MRL/lpr mice Rheumatology, September 1, 2004; 43(9): 1121 - 1128. [Abstract] [Full Text] [PDF]

				A. S. Pachori, L. G. Melo, M. L. Hart, N. Noiseux, L. Zhang, F. Morello, S. D. Solomon, G. L. Stahl, R. E. Pratt, and V. J. Dzau Hypoxia-regulated therapeutic gene as a preemptive treatment strategy against ischemia/reperfusion tissue injury PNAS, August 17, 2004; 101(33): 12282 - 12287. [Abstract] [Full Text] [PDF]

				T. Wada, K. Furuichi, N. Sakai, Y. Iwata, K. Kitagawa, Y. Ishida, T. Kondo, H. Hashimoto, Y. Ishiwata, N. Mukaida, et al. Gene Therapy via Blockade of Monocyte Chemoattractant Protein-1 for Renal Fibrosis J. Am. Soc. Nephrol., April 1, 2004; 15(4): 940 - 948. [Abstract] [Full Text] [PDF]

				E. Imai Gene Therapy for Renal Diseases: Its Potential and Limitation J. Am. Soc. Nephrol., April 1, 2003; 14(4): 1102 - 1104. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Furuichi, K. Articles by Yokoyama, H. Search for Related Content PubMed PubMed Citation Articles by Furuichi, K. Articles by Yokoyama, H.