| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |



*Division of Matrix Biology, Department of Medical Biochemistry and Biophysics, and the
Division of Chemical Neurotransmission, Department of Neuroscience, Karolinska Institutet, Stockholm, Sweden; and
Biocenter and Department of Biochemistry, University of Oulu, Oulu, Finland.
Correspondence to Dr. Karl Tryggvason, Division of Matrix Biology, Department of Medical Biochemistry and Biophysics, Karolinska Institutet, 171 77 Stockholm, Sweden. Phone: 46-8-728-7720; Fax: 46-8-31-61-65;
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Nephrin was the first molecule to be localized to the slit diaphragm (3). The structure of this primary size-selective filter in the glomerulus has been poorly understood, but significant progress has been made recently in identifying and characterizing its components (4). Nephrin has been proposed to form a zipper-like filter structure, which prevents molecules of the size of albumin and larger to penetrate the filter (4). Recently other proteins such as ZO-1, synaptopodin, p-cadherin, CD2AP, podocin, and FAT have been shown to localize in the slit diaphragm region (510).
In addition to the kidney, nephrin expression has been observed in the central nervous system, developing spinal cord, cerebellum, mesencephalon, and olfactory bulb (2,11). The presence of nephrin in brain and spinal cord generated a lot of questions regarding its extrarenal functions. Speculations about its involvement in the neurologic symptoms, observed in some CNF patients, have been made (11). Another extrarenal site of nephrin expression is the insulin-producing
-cells of the pancreas (2,12).
The complex pattern of tissue and cell lineagespecific expression (11) and the existence of splice variants (13,14) imply complex regulation of the nephrin gene. Studies on the mouse promoter in transgenic mice have shown that a 4.1-kb segment of the upstream region in the mouse gene can drive expression in both kidney and brain (15), whereas no expression was observed in the pancreas of these animals. In the case of the human promoter, a considerably shorter upstream sequence of 1.25 kb was found to drive expression of a reporter gene in podocytes of transgenic mice, but no data were presented on extrarenal expression with that construct (16).
In the present study, we have examined the regulation of the mouse nephrin gene using a variety of promoter constructs in transgenic mice. The purpose of this work was to try to determine the transcription mechanisms involved in the tissue-specific expression of the gene.
| Materials and Methods |
|---|
|
|
|---|
Gal-basic vector (Clontech). For microinjections, the nephA constructs plasmid was linearized, and the vector sequence other than the reporter gene was excised using the KpnI and SalI restriction sites within the vector. Constructs nephB (-4013 to -4 bp) and nephC (-2148 to -4 bp) were generated through linearization of construct nephA with SalI digestion from the 3' end and ScaI as well as BsaI from the 5' end. Construct nephB-
700 (-4013 to -1908 and -1249 to -4 bp) was created by introducing a PstI deletion in nephA, religation, and consequent linearization with ScaI and SalI. The fifth construct, nephA-
500 (-6242 to -546 bp), contains a SpeI and BclI fragment cloned in the NheI/BglII digested p
Gal-basic vector. It was linearized using KpnI and SalI restriction sites within the vector.
|
-galactosidase gene. A pair of primers from the
globin gene, 5'CCAATCTGCTCACACAGGATAGAGAGGGCAGG3' and 5'CCTTGAGGCTGTCCAAGTGATTCAGGCCATCG3', were used as an internal positive control. Staining for
-galactosidase activity in whole embryo (E12.5) or isolated tissues (E14.5 and E17.5) was performed as described previously (18). The embryos or tissue samples were paraffin-embedded, and 3- to 5-µm sections were counter-stained with eosin.
RNA Isolation, 5'RACE, and RT-PCR
Total RNA was isolated from mouse kidney and cerebellum using the Trizol reagent (Life Technologies). Identification of the transcription start site was performed using a SMART RACE cDNA amplification kit (Clontech) and gene-specific primers 5' CAGAAGCAGCCCATCCTTAGC3' and 5'ACTGTGCTTCCTGCCTCA3' from exons 2 and 4, respectively. The PCR products were cloned with Topo TA cloning kit (Invitrogen) and sequenced using an ABI 310 automatic sequencer (Applied Biosystems).
Analyses of cDNA and Amino Acid Sequences
Homology searches were performed using FASTA (Genetics Computer Group) and BLAST (GenBank). For signal peptide predictions, SPScan program (Genetics Computer Group) and SIGFIND (19) database were used. Mouse/human homology searches and analysis for putative transcription factor recognition sites were performed using mVISTA and rVISTA scan, respectively (2022).
Immunohistochemical Analyses
Newborn, nephrin knockout (n = 4), and wild-type and heterozygous littermates (n = 12) were perfused transcardially under ether anesthesia with 1 ml of Tyrode Ca2+-free solution at 37°C followed by perfusion with 2 ml of an ice-cold mixture of 4% paraformaldehyde and 0.4% picric acid in 0.16 M phosphate buffer (pH 6.9) at 37°C. After perfusion, the bodies were immersed in the same fixative for 60 min and for 60 more min after opening the brain surface. The brains were washed in 10% sucrose in 0.1 M phosphate buffer (pH 7.4) overnight and then snap-frozen using CO2. Fourteen-micrometer thick coronal brain sections were cut on a cryostat (Microm, Heidelberg, Germany) and thaw-mounted on chrome alum-gelatincoated glass slides. Immunohistochemical analyses were performed using the tyramine signal amplification (TSA) (23). A polyclonal rabbit anti-mouse antiserum (1:200) raised against the intracellular part of nephrin (2) was applied to the sections overnight at 4°C, followed by incubation with horseradish-peroxidase-conjugated swine anti-rabbit IgG (1:100; Dako A/S, Copenhagen, Denmark) and components of the TSA-Plus Fluorescein System (DuPont, New England Nuclear, Boston, MA). Sections were mounted in a mixture of glycerol and 0.1 M phosphate-buffered saline (3:1), pH 7.4, containing 0.1% 1,4-phenylenediamine (Sigma Chemicals, St. Lois, MO), and examined by Bio-Rad Radiance Plus (Bio-Rad, Hemel Hemstead, UK) confocal laser scanning microscope installed on a Nikon (Nikon, Tokyo, Japan) Eclipse E600 fluorescence microscope. Digital images resulting from the confocal scanning microscopy were optimized for image resolution. The specificity of the antibodies was tested by preabsorbtion tests with an excess (10-6 M) of nephrin protein.
| Results |
|---|
|
|
|---|
General Localization of Tissue-Specific Enhancers in the Mouse Nephrin Gene
Two constructs containing 6242 (nephA) and 4013 bp (nephB) of the upstream region and the 5' UTR (with the exception of bases -1 to -3), were strongly expressed in podocytes (Figure 2A) and central nervous system (data not shown). Weak lacZ staining was also observed in pancreas (Figure 2B). Essentially the same expression pattern has been described for the endogenous nephrin gene (2). A third construct (nephC), containing 2148 bp of the upstream region and the 5' UTR, did not yield any expression, indicating that the region between -2148 and -4013 contains cell lineagespecific enhancer elements. When a 700-bp segment between bases -1249 and -1908 was deleted from construct nephB (nephB-
700), expression was observed only in podocytes (not shown) and brain (Figure 2C), but not in the spinal cord (Figure 2C) and pancreas (not shown).
|
500. This construct lacked the 5' UTR, including the transcription initiation site and part of the immediate promoter region; therefore, no expression was expected. Surprisingly, the transgenic embryos showed strong lacZ staining in the central nervous system (Figure 2D) similar to that shown for the native nephrin promoter (2). No staining was observed in kidney or pancreas of mice containing this construct (not shown).
The highly tissue-specific expression from the negative control construct, nephA-
500, led us to believe that there might be an alternative transcription start site, and a novel exon(s) located upstream from the main transcription initiation site. To clarify this, we determined the 5' end of both kidney and cerebellar mRNA by 5' RACE. In the case of kidney mRNA, we found that the transcription start site was at position -381 bp, as counted from the translation initiation codon (ATG) in the cDNA (data not shown). The 5' RACE of mRNA from cerebellum yielded different results. In this case, the analysis revealed an alternative 5' end at position -1871 and, respectively, of a novel exon 1490 bp upstream from the transcription initiation site shown for kidney mRNA. The new exon (designated exon 1B) was spliced together with exons 2 through 29, with the sequence of exon 1 (from now on exon 1A) being absent from the cDNA (Figure 3). The sequence of exon 1B is shown in Figure 4. It is 271 bp in size and has a typical GT-donor site at its 3'-end. For both kidney and cerebellar nephrin isoforms, the first nucleotides from the cDNA are in agreement with the requirements for transcriptional initiation in mammalian cells (24). The ATG codon of the alternative exon was found to fit the Kozak consensus sequence (RNNatgG where R is purine) (25).
|
|
To examine if the novel nephrin isoform is possibly specific for rodents, we searched for the exon 1B sequence in the upstream region of the human nephrin gene. A BLAST search carried out with the public database yielded the presence of such a tentative exon about 3.7 kb upstream of the ATG translation initiation codon in exon 1A (GenBank accession no. AC002133). Similar results were achieved with BlastN search in Celera database (GA_x54KRE9Q4RC). The possible N-terminal sequence of this putative human brainspecific isoform is shown on Figure 4. Thus, the human nephrin gene is also likely to generate the two nephrin isoforms described here for the mouse, but so far there are no reports on the presence of nephrin in human brain.
Evidence for Central Nervous System Specificity of the Nephrin Isoform Encoded by Exon 1B
The identification of this new splice isoform of nephrin prompted us to reconsider the situation with the nephrin knockout mice previously created in our laboratory. As described elsewhere, the nephrin knockout was generated by disruption of exon 1A (2). Neither nephrin mRNA nor nephrin protein were observed in the kidneys of the -/- mice. However, on the basis of the results obtained in the present study, one could expect that the knockout animals still express nephrin in the brain through the use of exon 1B. To explore this, we performed immunohistochemical staining of brain sections from newborn -/- mice using antiserum raised against the intracellular part of the mouse nephrin (2). At the light microscopy level, this did indeed yield quite similar distribution of immunoreactivity in the brains of the knockout mice as observed in their wild-type or heterozygous littermates (Figure 5). In the cerebral cortex, a moderate, diffuse signal, most prominent in the cortical lamina I of the cingulate and retrosplenial cortical areas was observed (Figure 5, A through C). Weak staining was seen in the deeper cortical layers, apparently in processes running perpendicularly to the surface. Immunostaining was also observed in the choroid plexus, particularly in the apical parts of the epithelial cells (Figure 5D). The strongest staining was found in the cells located in the pia and arachnoid maters (Figure 5, E and F). A moderate signal was observed in the hypothalamus: in the fornix and the presumable axons of the magnocellular neurons terminating in the posterior pituitary (Figure 5G). A preadsorption test of the antiserum with nephrin protein entirely abolished the nephrin immunoreactivity (Figure 5H). Immunostaining of knockout kidneys was used as a control and showed no signal for nephrin (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
Our results with nephB-
700 construct showing strong kidney and brain expression indicate that an important podocyte-specific enhancer element is located in the region between -4 kb and -2.1 kb. The strong sequence homology between the mouse and the human genes in this region revealed in the VISTA-plot supports this notion (Figure 6). This is in agreement with the previous work of Moeller et al. (26) and Eremina et al. (15), who localized such elements to upstream gene regions smaller than -5.4 kb and -4.1 kb, respectively. However, in a more recent article, Moeller et al. (27) showed evidence for weak kidney activity in a construct containing 1.25 kb from the upstream region of the mouse nephrin gene. This contradicts the present study, as a construct containing 2.15 kb did not reveal expression of the reporter gene in podocytes or any other tissues normally expressing nephrin in four independent mouse lines. These results could mean that the 1.25-kb upstream region only has a weak kidney enhancer that is inhibited by suppressor elements in the region between -2.15 kb and -1.25 kb, while other significant podocyte specific regulatory elements reside in the region -4 kb to -2.1 kb. This hypothesis could explain the peculiar results we obtained with a 1214-bp promoter construct (unpublished data). We observed podocyte staining in one of two founder lines generated with that construct. However, the mice from both lines also had clearly ectopic, extrarenal lacZ staining in tissues such as brain, cartilage, and bone. This may be due to an integration sitedependent influence over the weak podocyte-specific elements contained in this fragment.
Another conclusion that can be drawn when comparing the results obtained with constructs nephB and nephB-
700 is that important regulatory elements, required for expression in pancreas and spinal cord, reside in the region between -1249 and -1908. Previous reports on studies in transgenic mice with lacZ expression constructs similar to nephB or longer did not report on expression in the pancreas. This can probably be explained by the extremely weak and difficult to observe expression, rather than by difference in the sequence of the constructs used in these studies.
The observation that construct nephA-
500 lacking the minimum promoter and the 5' untranslated region was expressed strongly in brain and spinal cord was intriguing, and it led us to identify the novel alternative exon 1B. The existence of this isoform was nicely demonstrated in our nephrin knockout mice, where exon 1A was deleted and exon 1B was clearly functional. We thus observed nephrin in the brain by immunostaining, although the kidneys remained completely negative for both mRNA and the nephrin protein (2). RT-PCR also showed that exon 1A is expressed in both kidney and brain, whereas exon 1B is brain-specific (data not shown).
Interestingly, it was shown here for the first time that nephrin is expressed in brain choroid plexus. This was observed for both nephrin -/- and wild-type mice (Figure 5, E and G). Similar results were obtained for rat brains (data not shown). Choroid plexus is involved in the blood filtration in the blood/brain barrier, and nephrin has been shown to be essential for the filtration in kidney; therefore, one could speculate about a possible role of nephrin for this process in brain.
The biologic role and exact location of the two nephrin isoforms in the brain remain to be clarified. Although exon 1A codes for a typical signal peptide, analysis of the sequence encoded by exon 1B did not reveal a possible signal peptide nature. Searches in the Celera and public databases showed no homology of the alternative nephrin isoform to previously characterized sequences. Light microscopy immunohistochemical analyses of both exon 1A and exon 1B isoforms in the brain have not revealed any clear differences in location. Immunoelectron microscopic studies are being performed to shed more light on the location of the two isoforms in the brain.
Whatever the function of the two isoforms in the brain, it is clear that the renal isoform of nephrin is essential for life. Whether or not the exon 1B isoform has some important function in the brain remains to be found. One future study attempting to solve this question should include deletion of both exons 1A and 1B.
An extensive body of data has been accumulated on transcription factors and signaling pathways involved in the development of kidney podocytes, and the involvement of some of them in nephrin expression has been studied. For example, Pod1 and LMX1B, known to play role for podocyte differentiation, have been shown to have no effect on nephrin expression (16,28). Another transcription factor with a major role in kidney development and podocyte differentiation is WT1. Although no induction of nephrin expression was observed in rat embryonic kidney cells transfected with inducible WT1 (29), a more recent study shows that absence or even reduction of WT1 expression causes decrease of the nephrin expression or completely abolishes it (30). These results show that WT1 may have important role for regulation of the nephrin expression but requires activation of other transcription factors. Although the current knowledge about actual trans-acting factors controlling nephrin gene expression is limited, it is of great interest that modulation of the renin/angiotensin system and protein kinase C have been shown to affect regulation of the nephrin gene in kidney cells (31,32).
Thorough studies on the regulatory mechanisms of the nephrin gene may have clinical importance and may help to elucidate the role of nephrin for podocyte differentiation and its function in central nervous system. Our data show that the nephrin gene expression is controlled by tissue-specific elements in the region -4kb to -2.1 kb and alternative splicing in the 5' end of the gene. The present work gives a basis for future detailed studies on the transcription factors involved in the regulation of the nephrin gene.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Daimon, G. Ji, T. Oizumi, T. Kido, M. Baba, Y. Jimbu, W. Kameda, S. Susa, H. Yamaguchi, H. Ohnuma, et al. Association of Nephrin Gene Polymorphisms With Type 2 Diabetes in a Japanese Population: The Funagata Study Diabetes Care, May 1, 2006; 29(5): 1117 - 1119. [Full Text] [PDF] |
||||
![]() |
C. D. Cohen, A. Klingenhoff, A. Boucherot, A. Nitsche, A. Henger, B. Brunner, H. Schmid, M. Merkle, M. A. Saleem, K.-P. Koller, et al. Comparative promoter analysis allows de novo identification of specialized cell junction-associated proteins PNAS, April 11, 2006; 103(15): 5682 - 5687. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Cybulsky, T. Takano, J. Papillon, and K. Bijian Role of the Endoplasmic Reticulum Unfolded Protein Response in Glomerular Epithelial Cell Injury J. Biol. Chem., July 1, 2005; 280(26): 24396 - 24403. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Cohen, P. P. Doran, S. M. Blattner, M. Merkle, G. Q. Wang, H. Schmid, P. W. Mathieson, M. A. Saleem, A. Henger, M. P. Rastaldi, et al. Sam68-Like Mammalian Protein 2, Identified by Digital Differential Display as Expressed by Podocytes, Is Induced in Proteinuria and Involved in Splice Site Selection of Vascular Endothelial Growth Factor J. Am. Soc. Nephrol., July 1, 2005; 16(7): 1958 - 1965. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wagner, K.-D. Wagner, Y. Xing, H. Scholz, and A. Schedl The Major Podocyte Protein Nephrin Is Transcriptionally Activated by the Wilms' Tumor Suppressor WT1 J. Am. Soc. Nephrol., December 1, 2004; 15(12): 3044 - 3051. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Guo, D. J. Morrison, J. D. Licht, and S. E. Quaggin WT1 Activates a Glomerular-Specific Enhancer Identified from the Human Nephrin Gene J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2851 - 2856. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |