 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
MAPK Ameliorates Acute Inflammatory Renal Injury in Rat Anti-GBM Glomerulonephritis
*Department of Nephrology and Monash University Department of Medicine, Monash Medical Centre, Clayton, Victoria, Australia; Scios Inc., San Francisco, California; and Department of Anatomical Pathology, St. Vincent’s Hospital, Melbourne, Australia.
Correspondence to Dr. Cosimo Stambe, Dept of Nephrology, Monash Medical Centre, 246 Clayton Rd, Clayton, Melbourne, Australia, 3168. Phone: 61-395943528; Fax: 61-395946530;
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, p-p38, p-ATF-2) in normal glomeruli, to podocytes, and occasional endothelial cells. This study identified an eightfold increase in glomerular activation of p38 MAPK (phosphorylated p38, p-p38) within 3 h of the induction of rat anti–glomerular basement membrane (GBM) glomerulonephritis and localized p-p38 and p-ATF-2 to infiltrating neutrophils, with increased staining of podocytes and endothelial cells. The relevance of these findings to human acute inflammatory renal disease was determined by examination of biopsy specimens. In patients with post-infectious glomerulonephritis, there was an increased number of positive p-p38 glomerular cells, including p-p38 staining of infiltrating neutrophils, compared with normal human kidney. In rats, administration of a specific p38 MAPK inhibitor, NPC 31145, before induction of anti-GBM disease prevented a loss of renal function and substantially reduced proteinuria. The reduction in renal injury was attributed to a 55% reduction in glomerular neutrophil infiltration and a 68% reduction in platelet accumulation. This was associated with an abrogation of glomerular P-selectin immunostaining and inhibition of glomerular P-selectin gene expression. In summary, this study has localized the components of the p38 MAPK pathway to cells in normal and diseased rat and human kidney and identified a number of important mechanisms by which signaling through the p38 MAPK pathway induces inflammatory renal disease. Blockade of the p38 pathway may be a novel therapeutic strategy for the treatment of acute renal inflammation. E-mail: cosimo.stambe@med.monash.edu.au |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(IL-1) and tumor necrosis factor alpha (TNF-) (1,3–5). There are four isoforms of p38 MAPK, termed p38, , 
, and 
, which share a close sequence homology and are activated by phosphorylation of Thr and Tyr in a Thr-X-Tyr motif by mitogen-activated protein kinase kinases (2,6). Much of our understanding of how p38 MAPK signaling promotes the inflammatory response is based on cell culture studies. Although a limited number of studies have identified a pathologic role for the p38 MAPK pathway in animal models of inflammatory disease (7–11), we have little knowledge of how the p38 MAPK pathway contributes to inflammation in vivo. For example, in which cell types is p38 MAPK activated, and which inflammatory mechanisms are dependent on p38 MAPK? We therefore examined a model of acute inflammatory renal injury to (1) identify the cell types in which p38 MAPK is activated; (2) determine the functional significance of p38 MAPK in acute renal injury; and (3) examine mechanisms of inflammation that are dependent on p38 MAPK activation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Antibodies
The following mouse monoclonal antibodies were used in this study: anti-p38 (anti-SAPK2a, #05 to 454; Upstate, New York, NY), anti-phosphorylated p38 (p-p38, #M1877; Sigma-Aldrich, St. Louis, MO), raised against the phosphorylated p38 peptide and recognizing all the phosphorylated p38 isoforms, anti-phospho-c-Jun (p-c-Jun, #sc-822; Santa Cruz Biotechnology, Santa Cruz, CA), anti-CD68 recognizing rat macrophages (Serotec, Oxford UK), anti-Reca-1 recognizing rat endothelium (Serotec), anti-rat granulocyte recognizing the RP-1 antigen on rat neutrophils (#22815D; Becton Dickinson, San Diego, CA), anti-human neutrophil cathepsin G (#554248; Becton Dickinson), anti-desmin recognizing rat podocytes (M0760; Dako, Glostrup, Denmark), anti-rat CD42d recognizing platelet gylcoprotein V (#22771D; Becton Dickinson), and anti-1-tubulin (#T9026; Sigma-Aldrich). Rabbit polyclonal antibodies used were: anti-p-ATF-2 (#9221; Upstate) and anti-CD62P (#553716; Becton Dickinson). Horseradish peroxidase and alkaline phosphatase-conjugated goat anti-mouse IgG, and mouse peroxidase conjugated anti-peroxidase complexes (PAP) and alkaline phosphatase conjugated anti-alkaline phosphatase complexes (APAAP) were purchased from Dako. p-p38, p-c-Jun amino terminal kinase (p-JNK), p-ATF-2, and p-c-Jun peptides were kindly provided by Cell Signaling Technology (Beverely, MA).
Western Blot Analyses
At sacrifice, the right kidney from each animal was dissected and placed immediately into ice-cold PBS and sieved sequentially through 250-µm, 150-µm, and 75-µm mesh to obtain glomerular and tubular fractions. The purity of separation was visually determined by light microscopy to be greater than 95% for glomeruli and greater than 98% for tubular fragments. The fractions were centrifuged and then resuspended in 0.5 or 1.0 ml of lysis buffer containing 10 mM Tris-HCl, pH 7.4, 100 mmol of NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 2 mM Na3VO4, 1% deoxycholate, 0.1% SDS, 1% Triton X-100, 0.5% deoxycholate, 1 mM PMSF, and 10% proteinase inhibitor (Sigma-Aldrich, St Louis, MO) on ice for 30 min, vortexing every 2 min. The samples were centrifuged at 14,000 rpm for 10 min, and the supernatant was stored at -80°C. Protein estimations were performed using a Bradford assay (Pierce). Glomerular protein was loaded at 80 µg per well and separated by SDS-PAGE on a 12.5% acrylamide gel. Gels were electroblotted onto a PVDF membrane, and the blots were incubated for 4 h in 20 ml of blocking buffer (50 mM Tris- HCl, 350 mM NaCl, 0.5% Tween 20, with 5% skim milk). Blots were then washed three times in wash buffer (50 mM Tris-HCL, 350 mM NaCl, 0.02% Tween 20, pH 7.5) and incubated with either anti-p38 (1 µg/ml) or anti-p-p38 (2 µg/ml) in 5% BSA in wash buffer overnight at 4°C. Blots were then washed three times, incubated with horseradish peroxidase–conjugated goat anti-mouse IgG for 2 h at room temperature, and washed twice in wash buffer; the membrane-bound antibody was detected by chemiluminescence and captured on x-ray film.
Membranes were re-probed with anti-1 tubulin to determine equivalence of protein loading. Immunostaining for 1 tubulin in normal rats and at 3 h and 24 h after induction of anti-GBM disease demonstrated no change in both the extent and intensity of stain verifying its use as a loading control (data not shown). Membranes were stripped using stripping buffer (Chemicon International, Temecula, CA), re-blocked with 20 ml of blocking buffer for 4 h and incubated with anti-1 tubulin (1:2000) in 5% BSA in wash buffer overnight at 4°C. They were then washed three times, incubated with horseradish peroxidase–conjugated goat anti-mouse IgG, washed in wash buffer, and developed with chemiluminescence and captured on x-ray film. Densitometry analyses were performed using Gel Pro analyzer program (Media Cybernetics, Silver Spring, MD).
Human Renal Biopsies
Permission for the use of human biopsy tissue was granted by the human ethics committee of Monash Medical Center, and written informed consent was obtained from the patients. Sections of renal biopsy specimens were acquired in patients in which a renal biopsy was being performed in accordance with normal patient management and in which the tissue was in excess of that required for normal diagnostic purposes. Formalin-fixed paraffin sections of human renal biopsy specimens from three patients with normal renal biopsies and three patients with post-infectious glomerulonephritis were examined.
Immunohistochemistry
For each animal, slices of the left kidney were immediately snap frozen (SF) or fixed in 4% buffered formalin for paraffin embedding or 2% paraformaldehyde-lysine-periodate (PLP) and then frozen. Two-color immunohistochemical staining on 4-µm sections was performed as described previously (13). Paraffin sections of formalin-fixed tissues were dewaxed in histosol, rehydrated, and microwave oven heated in 0.1 M sodium citrate for 10 min. The sections were then washed in PBS and blocked with 10% normal sheep serum and 10% fetal calf serum for 30 min and incubated with anti-p38 (1 µg/ml), anti-p-p38 (5 µg/ml), anti-p-c-Jun (1 µg/ml), and anti-p-ATF-2 (1:1000) in 10% normal rat (or human) serum, 1% BSA overnight at 4°C, washed, endogenous peroxidase–inactivated in 1% H2O2 in methanol for 20 min, incubated with horseradish peroxidase–conjugated goat anti-mouse (or rabbit) IgG followed by mouse (or anti-rabbit) PAP, and developed with 3,3-diamenobenzidine to produce a brown color. When double-labeling, sections were given a second treatment of microwave oven heating, blocked with 10% normal sheep serum and 10% fetal calf serum and incubated with anti-RP-1 (1 µg/ml), anti-Reca-1 (1:100), or anti-human neutrophil cathepsin G (20 µg/ml) overnight at 4°C in 10% normal rat (or human) serum and 1% BSA, washed, then incubated with either alkaline phosphatase-conjugated goat anti-mouse IgG and finally with APAAP, and developed with Fast Blue BB Salt (Ajax Chemical, Melbourne, Australia) to produce a blue color (rat neutrophil staining), or once again peroxidase-inactivated in 1% H2O2 in methanol for 20 min, incubated with horseradish peroxidase–conjugated goat anti-mouse IgG followed by mouse PAP, and developed with Vector SG (Vector Laboratories, Burlingame, CA) to produce a gray color (rat endothelial, human neutrophil staining). Some sections were counterstained with periodic acid-Schiff (PAS) reagent with or without hemotoxylin and mounted under glycerol medium. For P-selectin staining (anti-P-selectin antibody at 15 µg/ml) and platelet staining (anti-CD42d at 5 µg/ml), SF tissue was fixed in 100% ethanol at 4°C for 10 min and the staining protocol followed (without microwave) as described above.
Specificity of p-p38 immunostaining was demonstrated by pre-incubating the anti-p-p38 antibody with a tenfold molar excess of p-p38 or p-pJNK peptides for 30 min at room temperature before incubation of the sections. Specificity of p-ATF-2 immunostaining was demonstrated by pre-incubating the anti-p-ATF-2 antibody with a tenfold molar excess of p-ATF-2 or p-c-Jun peptides for 30 min at room temperature before staining of tissue sections. Specificity of p38 staining was demonstrated by substitution of the anti-p38 antibody with an irrelevant isotype-matched antibody during the staining protocol.
NPC 31145 Kinase Assays
NPC 31145 was developed by Scios Inc. This drug does not affect phosphorylation of p38, but it inhibits the ability of p-p38 to phosphorylate its downstream targets, such as ATF-2. Its specificity for p38 inhibition was determined against a variety of enzymes in kinase assays. Individual kinases were isolated from cell lysates by immunoprecipitation with specific antibodies bound to Sepharose beads. Kinase assays were performed as described previously (14). Briefly, kinases were incubated with their specific target substrates together with 0.1 mM [32P]ATP and 10 mM magnesium acetate in the presence of increasing concentrations of NPC 31145 for 10 min at 30°C. Protein was precipitated on filter paper and washed three times in 50 mM phosphoric acid to remove ATP, and radioactivity was counted. The concentration of NPC 31145 required to inhibit kinase activity by 50% was recorded as an IC50 value. NPC 31145 inhibits the kinase activity of p38 with an IC50 of 0.019 µM. The specificity of the compound for p38 was over 15-fold greater than for the closely related kinase isoform p38. There was no significant activity of NPC 31145 against any of the other kinases investigated (Table 1).
|
Experiment 2.
Groups of 15 animals were gavaged with NPC 31145 at 40 mg/kg in polyethylene glycol 400 or with vehicle alone 2 h before intravenous injection of anti-GBM serum. Blood samples were taken from the tail vein immediately before gavage of the drug or vehicle (-2 h). After injection of anti-GBM serum, animals were placed immediately into metabolic cages for 24 h for urine collection and protein estimations. A further dose of NPC 31145 was administered by gavage 12 h after the initial dose (10 h after anti-GBM serum injection). Animals were killed 24 h after injection of anti-GBM serum, and blood and tissue were collected. Serum creatinine, white cell, and platelet counts were analyzed by the Department of Biochemistry, Monash Medical Center.
After immunostaining of tissues, sections were scored for the number of positively stained cells. The number of RP-1–positive neutrophils and ED1-positive macrophages were counted in 20 glomerular cross-sections. The number of T cells was counted in 50 glomerular cross-sections. To quantify activation of the p38 and JNK pathways in intrinsic glomerular cells (defined as RP-1–negative cells in double-stained sections), the number of p38, p-p38, p-ATF-2, or p-c-Jun positive were scored in 20 glomerular cross-sections. The results are expressed as cells per glomerular cross-section (cells/gcs ± SD). Glomerular platelet accumulation was assessed by digital photography of 20 glomeruli per animal (Image-Pro Plus Software), and the results were expressed as a percentage (± SD) of glomerular cross-section stained. Human renal biopsy specimens were also assessed for p38 pathway activation in intrinsic glomerular cells. The number of p-p38–positve, cathepsin G–negative cells were counted in all glomeruli (range, 14 to 22), and the results were expressed as cells per glomerular cross-section (cells/gcs ± SD). All counting was performed on blinded slides.
Real-Time Quantitative RT- PCR
Real-time RT-PCR was performed as described previously (15). Briefly, total glomerular RNA was analyzed by quantitative real-time PCR using an ABI Prism 7700 Sequence Detection System (PE Applied Biosystems, Foster City, CA). Relative quantitation of P-selectin and 18S mRNA were calculated using the comparative threshold cycle number for each sample fitted to a five-point standard curve (ABI Prism 7700 User Bulletin #2, PE Applied Biosystems, Foster City, CA). Expression levels were normalized to 18S ribosomal RNA. The following sequence-specific primers were used: rat P-selectin forward primer: 5'TGCAGAGCCGTCAAATGCT, reverse primer: 5'GGACAGTGGAAGGCACAGGTT, and probe: 5'CACATGGACACAGCAGTCGCGATG; 18S forward primer: 5'CGGCTACCACATCCAAGGAA, reverse primer: 5'GCTGGAATTACCGCGGCT, and probe: 5'TGCTGGCACCAGACTTGCCCTC. Primers were used at a concentration of 200 nM, and probes at 100 nM in each reaction. Multiscribe reverse transcriptase and AmpliTaq Gold polymerase (PE Applied Biosystems, Foster City, CA) were used in RT-PCR reactions. RT-PCR parameters were as follows: 48°C for 30 min (reverse transcription), 95°C for 10 min (AmpliTaq Gold activation), and 40 cycles of 95°C for 15 s, 60°C for 1 min. Relative quantitations of gene expression were calculated using standard curves and normalized to 18S.
Electron Microscopy
Tissue for electron microscopy was fixed in 1.25% glutaraldehyde in 0.2 M sodium cacodylate overnight. The tissue was then post-fixed in 1% osmium tetroxide for 2 h and stained with 2% uranyl-acetate en-bloc for 1.5 h. It was then dehydrated in 50% alcohol for 10 min and 75% alcohol for 15 min, infiltrated with LR White resin for 1 h and then in resin overnight. The tissue was embedded in LR White resin and polymerized at 58°C for 2 h. Sections were cut at 0.5 µm and stained with methylene blue. Thin sections were then cut using a Reichert OM U3 ultramicrotome, stained with lead citrate, and examined using a Phillips 301 electron microscope.
Statistical Analyses
Data are presented as mean ± 1 SD. Comparisons were made between groups of animals by ANOVA, using Bonferroni correction for multiple comparisons (GraphPad Software, San Diego, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and p-p38 within the isolated normal glomeruli (Figure 1). By immunohistochemistry, we were able to show p38 in some glomerular cells, mostly podocyte-like cells (Figure 2a) and in many cortical tubules (data not shown). In addition, immunostaining of normal kidney demonstrated that p-p38 is localized mostly to podocytes-like cells (Figure 2b) and occasionally endothelial cells (Figure 3a) with some staining of tubules (not shown). Immunostaining for p-ATF-2 demonstrated a pattern similar to that of p-p38, with predominantly podocyte-like cell expression (Figure 2e).
|
|
|
at 3 h after induction of anti-GBM disease (Figure 1). There was an eightfold increase in the ratio of p38 to 1-tubulin, which subsequently decreased, although it was still elevated beyond normal 24 h after disease induction. Glomerular p-p38 paralleled p38, with a peak occurring at 3 h followed by a subsequent decline (Figure 1). This disease model is characterized by early leukocyte infiltration, and double immunostaining demonstrated p38, p-p38 and p-ATF-2 in most infiltrating neutrophils (Figure 2, b, d, and f). The number of intrinsic renal cells positive for p38, p-p38, and p-ATF-2 was also increased in disease (Figure 2, b, d, and f and Figure 4), and this was due in part, to a substantial increase in endothelial p-p38 staining (Figure 3, a and c). Furthermore, the endothelial p-ATF-2 staining suggested endothelial p38 MAPK activation (Figure 3, b and d).
|
|
inhibitor, NPC 31145, a compound with little activity against other kinases (Table 1). Renal function deteriorated in vehicle-treated animals 3 h after the injection of anti-GBM serum, with an 80% increase in serum creatinine compared with normal (experiment 1) and persisted 24 h after induction of the disease (experiment 2; Figure 6). In contrast, NPC 31145 treatment preserved normal renal function, such that the serum creatinine in these animals was not different from that of normal animals (Figure 6a). In a 24-h study (experiment 2), animals treated with vehicle alone developed massive proteinuria. In contrast, administration of NPC 31145 at 40 mg/kg twice daily reduced the proteinuria by 60% (Figure 6b).
|
|
|
Blockade Reduces Phosphorylation of ATF-2 but Not c-Jun Transcription Factors- and p-p38–positive intrinsic glomerular cells was not reduced in animals treated with NPC 31145, as this drug is a post-phosphorylation inhibitor of p38.
p38 Inhibition Abrogates Glomerular P-Selectin Expression
Adherence of neutrophils and platelets to the endothelium is dependent on the expression of adhesion molecules. P-selectin is an adhesion molecule, present within the Weibel-Palade bodies of normal endothelial cells and the alpha-granules of platelets, and it is not detectable in normal glomeruli by immunostaining at the light level. Early in the inflammatory process, surface expression of P-selectin, on both endothelial cells and adherent platelets is important for neutrophil accumulation (18,19). In vehicle-treated animals, P-selectin staining was seen in a patchy distribution within glomerular capillaries. This probably reflects P-selectin staining of adherent platelets and the glomerular endothelium, although it is difficult to unambiguously identify endothelial staining as separate from platelet staining by light microscopy. However, NPC 31145–treated animals had no discernable staining for glomerular P-selectin (Figure 9, a and b). Analysis of isolated glomeruli by real-time RT-PCR demonstrates that NPC 31145 treatment inhibited P-selectin gene transcription (Figure 9c).
|
Blockade Does Not Prevent Neutrophil-Mediated Endothelial Damage blockade (Figure 10).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, p-p38, p-ATF-2) to individual cell types within the normal and diseased kidney and demonstrated a functional role for this pathway in an experimental model of acute renal inflammation and injury. Although we have not identified the stressors for activation of the p38 pathway in renal inflammation, likely candidates are the pro-inflammatory cytokines IL-1 and TNF-, which play a pathogenic role in glomerulonephritis (20,21) and are potent stimuli for p38 MAPK activation via an upstream kinase, MKK3 (22,23).
Within normal kidney, p-p38 and p-ATF-2 is localized to podocyte-like cells, tubular epithelial cells, and occasional endothelial cells in a similar distribution to p38, suggesting that the isoform is activated. In anti-GBM disease, we have demonstrated that p38 and p-p38 increases within diseased glomeruli 3 h after induction of disease and localized p38, p-p38, and p-ATF-2 to infiltrating neutrophils and glomerular endothelial cells in addition to podocytes. A number of in vitro studies have demonstrated p38 activation in neutrophils and endothelial cells, but this is the first demonstration of p38 activation within these cell types in an inflammatory lesion. We demonstrated the relevance of these findings by examining p-p38 staining in human kidney. In normal human kidney, p-p38 is localized to podocytes with an increase in glomerular staining for p-p38 in human post-infectious glomerulonephritis, including staining within neutrophils. We and other investigators have demonstrated the presence of p-p38 in normal rat kidney by Western blotting and have confirmed the rapid activation of p38 MAPK in anti-GBM disease (24). However, our findings regarding the localization of active p38 contrast with a recent study of anti-GBM glomerulonephritis in WKY rats (25). In this study, virtually no p-p38 immunostaining was found in normal glomeruli, even though glomerular p-p38 has been demonstrated in normal rat kidney by Western blotting in several studies (24,26). Furthermore, p-p38 immunostaining did not appear nuclear and was restricted to infiltrating cells, with no staining of intrinsic renal cells. We assume that this apparent discrepancy is due to the specific antibodies or the immunostaining method employed. Our study showed good agreement between immunostaining and Western blotting and had a clear association between the different elements of the p38 MAPK pathway, and the specificity of the p-p38 staining was confirmed using a phospho-peptide control.
The trigger for p38 MAPK activation in the normal kidney is not clear, but on the basis of the localization of p38, p-p38 and p-ATF-2, and known stimuli for p38 activation, it may be that osmotic stress as a result of ultrafiltration of blood in the glomerulus and in the concentration of urine in the tubules, as well as the relative hypoxic tubular microenvironment, induces p38 activation (27,28). Further studies are required to determine the exact nature of the stresses that activate the p38 MAPK and the physiologic role of this inflammatory pathway in normal rat kidney.
We have demonstrated a pathologic role of the p38 pathway in acute glomerular injury and identified at least one major mechanism of p38 involvement in acute inflammation in vivo. Renal injury was suppressed with the use of an inhibitor of p38, with preservation of renal function and a significant reduction in proteinuria. This renoprotection is interesting, as the physiologic role of the p38 pathway in normal renal function is not known, and it may be possible that p38 inhibition has a detrimental role on normal physiology. No adverse effects, however, were observed in a study administering NPC 31145 to normal rats for 2 wk (data not shown).
NPC 31145 does not prevent p38 phosphorylation. Therefore, the specificity of p38 inhibition was determined by assessment of the activation state of ATF-2, a downstream target of p-p38. The related MAPK pathway, c-Jun amino terminal kinase (JNK) is known to phosphorylate and activate both c-Jun, a component of the AP-1 transcription factor, and ATF-2, whereas the p38 MAPK signaling pathway is known to phosphorylate and activate ATF-2 but not c-Jun (29–32). NPC 31145 treatment reduced p-ATF-2 but not p-c-Jun immunostaining in neutrophils and intrinsic glomerular cells, indicating that NPC 31145 exerted a suppressive effect on p38 but not on JNK activation in an in vivo inflammatory model.
Glomerular neutrophil infiltration is important in the development of proteinuria and acute renal dysfunction (33). Neutrophil depletion has been shown to abrogate proteinuria and renal injury within the first 24 h after induction of the disease (17). In this study, inhibition of p38 reduced glomerular neutrophil accumulation by 55%. However, the renoprotection observed with NPC 31145 treatment may not only be due to a reduction in neutrophil aggregation, but it may be related to changes in the activation state of the neutrophils. In vitro studies have demonstrated the importance of p38 to the activation state of neutrophils (34–38). It is interesting that despite our demonstration of a reduction in neutrophil p-ATF-2 expression in vivo and hence inhibition of the p38 pathway, electron microscopy of glomeruli showed that neutrophils present are still able to cause disruption of the endothelium and exposure of the glomerular basement membrane. However, this is by no means conclusive data demonstrating a lack of suppression of neutrophil function. The 60% reduction in proteinuria associated with a 55% reduction in neutrophil infiltration does suggest that inhibition of renal injury is related to the reduction in neutrophil infiltration without alteration in neutrophil inflammatory function. The inhibition of neutrophil infiltration by p38 blockade has been described in one other in vivo study of non-immune lung injury (11).
We next examined possible mechanisms for the reduction in neutrophil accumulation. Glomerular neutrophil recruitment and adherence is dependent on both neutrophil-platelet and neutrophil-endothelial interactions via P-selectin adhesion molecule expression on the surface of both platelets and endothelium. We thus investigated the presence of glomerular platelets and P-selectin in vehicle-treated and drug-treated animals. NPC 31145 treatment reduced platelet adhesion by 68% compared with vehicle, and this is likely to have contributed directly to the reduction in neutrophil infiltration. This is the first study to have demonstrated a p38-dependent effect on platelet accumulation in vivo. Whether this reduction in platelet accumulation is as the result of inhibition of endothelial cell function or the result of a direct effect on platelet function is not known.
P-selectin is important for neutrophil and platelet recruitment in models of neutrophil-platelet–mediated injury. We demonstrated that the p38 MAPK pathway is activated within endothelial cells in acute inflammatory renal injury and that p38 blockade using NPC 31145 resulted in reduced neutrophil and platelet accumulation, most likely via inhibition of P-selectin cell surface expression. These findings are consistent with previous reports in which use of neutralizing antibodies to P-selectin have been shown to reduce platelet influx and neutrophil infiltration in acute renal inflammation (39–41), but they contrast with a study in which a synthetic P-selectin and L-selectin blocker failed to suppress glomerular neutrophil adhesion in acute rat anti-GBM glomerulonephritis (42). In addition, P-selectin gene knockout mice develop a more aggressive glomerulonephritis, with increased glomerular neutrophil accumulation (43,44). However, these P-selectin deficient mice exhibited a higher degree of neutrophilia and lack the soluble form of P-selectin, which has been shown to inhibit neutrophil adherence (45).
Using our immunohistochemical techniques, we were not able to distinguish whether P-selectin staining is restricted to the platelet surface or if it is also present on the endothelial cell surface. It is likely that the reduction in P-selectin immunostaining is as a consequence of a reduction in glomerular platelet numbers, as well as inhibition of P-selectin localization on the surface of platelets and endothelial cells. Increased glomerular P-selectin gene expression in control disease, as quantitated by real-time RT-PCR, was abrogated by NPC 31145 treatment, indicating that glomerular production of P-selectin is p38 MAPK-dependent.
The intracellular signaling mechanisms responsible for P-selectin expression are not well established. Although ATF-2 mutant mice demonstrate a reduction in P-selectin expression in lung and kidney (46), there is little direct evidence for the role of p38 activation in P-selectin expression. Our findings are in agreement with a recent report of p38 inhibition reducing cardiac P-selectin immunostaining in a model of ischemic injury (47).
In summary, we have localized components of the p38 MAPK pathway to podocyte-like cells, endothelial cells and infiltrating neutrophils in a model of acute renal inflammation. A similar pattern of p38 activation was observed in post-infectious glomerulonephritis, demonstrating the relevance of the animal studies. Furthermore, we demonstrated that blockade of the p38 pathway significantly inhibited acute renal failure and proteinuria in rat anti-GBM glomerulonephritis via a neutrophil-platelet and P-selectin–dependent mechanism. These studies suggest that blockade of the p38 MAPK pathway may be a novel therapeutic strategy for the treatment of acute renal inflammation.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  K Polzer, A Soleiman, W Baum, R Axmann, J Distler, K Redlich, A Kilian, G Kronke, G Schett, and J Zwerina Selective p38MAPK isoform expression and activation in antineutrophil cytoplasmatic antibody-associated crescentic glomerulonephritis: role of p38MAPK{alpha} Ann Rheum Dis, May 1, 2008; 67(5): 602 - 608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Y. Ma, G. H. Tesch, R. A. Flavell, R. J. Davis, and D. J. Nikolic-Paterson MKK3-p38 signaling promotes apoptosis and the early inflammatory response in the obstructed mouse kidney Am J Physiol Renal Physiol, November 1, 2007; 293(5): F1556 - F1563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sheryanna, G. Bhangal, J. McDaid, J. Smith, A. Manning, B. M.J. Foxwell, M. Feldmann, H. T. Cook, C. D. Pusey, and F. W.K. Tam Inhibition of p38 Mitogen-Activated Protein Kinase Is Effective in the Treatment of Experimental Crescentic Glomerulonephritis and Suppresses Monocyte Chemoattractant Protein-1 but Not IL-1beta or IL-6 J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1167 - 1179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Y. Jung, K. Chen, M. Kretzler, and C. Wu TGF-beta1 Regulates the PINCH-1-Integrin-Linked Kinase-{alpha}-Parvin Complex in Glomerular Cells J. Am. Soc. Nephrol., January 1, 2007; 18(1): 66 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, N. V. Campanale, R. J. Liang, J. A. Deane, J. F. Bertram, and S. D. Ricardo Inhibition of p38 Mitogen-Activated Protein Kinase and Transforming Growth Factor-{beta}1/Smad Signaling Pathways Modulates the Development of Fibrosis in Adriamycin-Induced Nephropathy Am. J. Pathol., November 1, 2006; 169(5): 1527 - 1540. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Okada, T. Inoue, T. Kikuta, Y. Watanabe, Y. Kanno, S. Ban, T. Sugaya, M. Horiuchi, and H. Suzuki A Possible Anti-Inflammatory Role of Angiotensin II Type 2 Receptor in Immune-Mediated Glomerulonephritis during Type 1 Receptor Blockade Am. J. Pathol., November 1, 2006; 169(5): 1577 - 1589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Stirling, K. M. Koochesfahani, J. D. Steeves, and W. Tetzlaff Minocycline as a Neuroprotective Agent Neuroscientist, August 1, 2005; 11(4): 308 - 322. [Abstract] [PDF]
|
|
|
|
|
|
C. Stambe, D. J. Nikolic-Paterson, P. A. Hill, J. Dowling, and R. C. Atkins p38 Mitogen-Activated Protein Kinase Activation and Cell Localization in Human Glomerulonephritis: Correlation with Renal Injury J. Am. Soc. Nephrol., February 1, 2004; 15(2): 326 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
