Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Z.
Right arrow Articles by Harris, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Z.
Right arrow Articles by Harris, R. C.
J Am Soc Nephrol 14:3147-3154, 2003
© 2003 American Society of Nephrology

BASIC SCIENCE

Importance of Functional EGF Receptors in Recovery from Acute Nephrotoxic Injury

Zoufei Wang*, Jian-Kang Chen*, Su-wan Wang*, Gilbert Moeckel{dagger} and Raymond C. Harris*

Departments of *Medicine and {dagger}Pathology, Vanderbilt University, Nashville, Tennessee

Correspondence to Dr. Raymond C. Harris, C-3121 Medical Center North, Departments of Medicine, Vanderbilt University, Nashville, TN 37232-4794. Phone: 615-322-2150; Fax: 615-343-2675; E-mail: ray.harris{at}vanderbilt.edu


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. Previous studies have demonstrated increased renal expression of EGF receptor (EGFR) and EGFR ligands in response to acute toxic or ischemic renal tubular injury and have indicated that exogenous administration of EGF accelerates recovery from such injury. However, no studies to date have proved definitively an essential role for EGFR-mediated responses in regeneration after tubule injury. To this end, waved-2 (wa-2) mice, which contain a point mutation in EGFR that reduces receptor tyrosine kinase activity by >90%, were studied. These mice have a mild phenotype (wavy coat, curly whiskers, and runted stature) and normally developed kidneys. Acute nephrotoxic injury was induced in wa-2 and wild-type mice with HgCl2. One day after HgCl2 injection, functional renal compromise was comparable in wild-type and wa-2 mice. However, the rates of recovery of serum blood urea nitrogen and creatinine levels were markedly slower in wa-2 mice. Histologic evidence of tubular injury also was more severe and persisted longer in wa-2 mice. Furthermore, their kidneys demonstrated reduced levels of DNA synthesis and increased TdT-mediated dUTP nick-end labeling staining. These studies indicate that functional EGFR activity is an essential component of the kidney’s ability to recover from acute injury and that EGFR may regulate genes involved in growth, repair, and cell survival in the kidney.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
After acute tubular injury, the mammalian kidney possesses a remarkable regenerative capacity that results in structural and functional recovery of damaged epithelial cells (1,2). One paradigm to explain the ability of the kidney to repair itself is that locally produced growth factors mediate proliferation and differentiation (3). In general, evidence for involvement of these candidate growth factors has included the following criteria: (1) determination of alterations in renal expression of the growth factor and/or its receptor after acute injury and/or (2) demonstration that exogenous administration of the growth factor accelerates recovery from experimental injury (2). However, no study to date has proved conclusively an essential role for any endogenously produced growth factor signaling pathway in the repair process. Therefore, the question remains whether there exists any specific endogenous growth factor or group of growth factors that is mandatory for this repair process.

In this regard, ligands to the EGF receptor (EGFR) have been shown to increase in response to a variety of experimental maneuvers that induce acute tubular injury, including ischemia/reperfusion, mercuric chloride, aminoglycoside toxicity, and folic acid administration (4–6). Similarly, EGFR expression and activation have been observed after acute renal injury (4,6–8). Administration of exogenous EGF or other EGFR ligands has also been shown to accelerate recovery from ischemic or mercuric chloride–induced nephrotoxicity (9–11).

To examine whether EGFR activation plays an essential role in recovery of renal structure and function after acute tubular injury, we used waved-2 mice (wa-2), which exhibit a spontaneous mutation of their EGFR that imparts ineffective receptor tyrosine kinase activity and markedly decreases receptor signaling (12,13). Our studies demonstrated a markedly decreased rate of both functional and structural recovery from acute mercuric chloride–induced nephrotoxicity in wa-2. Therefore, these studies provide definitive evidence that EGFR activation is a necessary component of the kidney’s program for recovery from acute injury.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
Wa-2 mice were maintained on a C57BL/6JEixC3H/HeSnJ/CD-1 background (14). Mice were maintained at the Animal Research Facility at the Veterans Affairs Medical Center, and all procedures were in accordance with the Guidelines for Care and Use of Experimental Animals. Experiments were performed on male mice between 9 and 11 wk of age.

Genotyping
Wa-2 homozygous mice can be readily identified at birth or shortly thereafter because they are smaller and have vibrissae that are shorter than wild-type mice and are bent. By weaning, the wavy pelage is apparent. In addition, PCR methods of genotyping were used routinely. The wa-2 mutation is a T to G transversion that results in a valine to glycine substitution at residue 743 and creates a Fok1 restriction site. Using a 5' primer in intron 17 of murine EGFR (ATAACCTGACACTTGTCAGAGTAC) and a 3' primer in exon 18 (TTTGCAATCTGCA CACACCAGTTG), a 326-bp fragment is generated. Fok1 selectively cleaves the wa-2 sequence to 166- and 160-bp fragments.

Mercuric Chloride Nephropathy
Unless otherwise indicated, experiments were performed in wa-2 and age-matched controls (wt) with the same genetic background. For inducing renal tubule injury, mice were given a single subcutaneous injection of mercuric chloride at a dose of 23 µmol/kg. For confirming that any observed differences between the groups was not due to differences in HgCl2 uptake, a subset of animals were administered HgCl2 as indicated above, and 24 h after injection, both kidneys were harvested from each mouse and subjected to mercury level analysis by the Diagnostic Center for Population and Animal Health (Lansing, MI). Briefly, the kidneys were dried for 5 h at 95°C, weighed, then digested overnight in 2.0 ml of concentrated nitric acid in sealed Teflon vessels at 95°C. Mercury concentration was analyzed by cold vapor atomic absorption spectrophotometry at 253.7 nm (Thermal Separation Products, Riviera Beach, FL) and reported on a dry weight basis.

Measurement of Renal Function
Less than 50 µl of blood was collected daily from the saphenous vein for detection of blood urea nitrogen (BUN). For detection of creatinine, a subset of animals were killed at days 1, 3, and 5. BUN and creatinine were measured using a colorimetric kit (Sigma Diagnostics).

Bromodeoxyuridine Detection
For determination of bromodeoxyuridine (BrdU) incorporation, mice received an injection injected 2 h before being killed on the indicated day, and BrdU immunohistochemistry was performed. Quantification was performed using previously described methods (15). Briefly, bright-field images from a Leitz Orthoplan microscope with a digital video camera were digitized by the BIOQUANT image analysis system and saved as computer files. Contrast and color level adjustment (Adobe Photoshop) were performed for the entire image, i.e., no region- or object-specific editing or enhancements were performed.

Tubule Injury
Tubular injury was rated on a scale of 0 to 3, where 0 = normal, 1 = <30% tubules injured, 2 = 30 to 60% injury, 3 = 60 to 100% injury. For evaluation of cell death, kidneys were removed at the first, third, and fifth day after administration of mercuric chloride. TdT-mediated dUTP nick-end labeling (TUNEL) was performed. TUNEL positivity was scored on a scale from 0 to 4, where 0 = normal, 1 = <25% cells positive, 2 = 25 to 50% positive, 3 = 50 to 75% positive, and 4 = 75 to 100% positive. The score represents the mean of 10 high-power field counted (200 cells per high-power field).

Immunoprecipitation and Immunoblotting
A subset of mice received 40 µg of EGF/animal (Sigma) and were killed at 0, 10, or 60 min. The kidneys were removed and immediately homogenized by 20 strokes with a dounce homogenizer in 30 ml of imidazole/sucrose buffer (3 mM imidazole, 250 mM sucrose [pH 7.4]) containing a cocktail of inhibitors (1 mM EGTA, 1 mM NaF, 1 mM Na3VO4, 1 mM N-ethylmaleimide, 0.4 mM leupeptin, 0.4 mM PMSF). An equal volume of high-salt buffer (20 mM HEPES, 300 mM NaCl, 5 mM magnesium acetate, 5 mM potassium acetate, 1 mM EDTA, 1% Triton X-100, 1% NP-40) was added to an aliquot of the crude homogenate. The mixture was incubated on ice for 20 min and then centrifuged at 10,000 x g for 10 min at 4°C, and the supernatant was used as a whole homogenate fraction. The supernatant was sonicated with an ultrasonic homogenizer, 60% duty cycle, 15 s, x2, and centrifuged at 2500 rpm in an Eppendorf centrifuge, 4°C, 10 min. The supernatant was incubated with 10 µl of rabbit polyclonal anti-EGFR antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for 2 h at 4°C and immunoprecipitated with protein A/G plus agarose. Protein samples were separated on 10% SDS-PAGE and detected with either anti-EGFR or antiphosphotyrosine antibodies.

Statistical Analyses
All values are presented as mean ± SEM. ANOVA and Bonferroni t tests were used for statistical analysis, and differences were considered significant at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Initial experiments examined expression of EGFR in kidneys of wa-2 and wt mice. As Luettke et al. (13) reported in liver and skin, comparable amounts of receptor were present in total kidney of both wt and wa-2 animals (Figure 1). After subcutaneous EGF administration, kidney EGFR tyrosine phosphorylation in wt was increased within 10 min and still detectable at 60 min. In contrast, EGFR tyrosine phosphorylation was markedly lower at both 10 and 60 min in wa-2 (Figure 1).



View larger version (71K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Time course of EGF receptor (EGFR) tyrosine phosphorylation in wild-type (wt) and waved-2 (wa-2) mice. Mice received 40 µmol of EGF and were killed 10 and 60 min later. Whole-kidney homogenates were immunoprecipitated with EGFR antibody and then divided into two aliquots, which were immunoblotted with antibodies to either phosphotyrosine or EGFR.

 
In preliminary studies, we had determined that a single subcutaneous injection of 23 µg/ml HgCl2 induced moderate tubular injury in wild-type mice on the C57BL/6 background, with only minimal mortality (Figure 2A). This dosage is similar to that previously reported by other investigators (16,17). Mice on the C3H background have been reported to have increased susceptibility to mercuric chloride (18). Because wa-2 mice were maintained on a mixed C57BL/6JEixC3H/HeSnJ/CD-1 background, initial studies were performed to determine whether wild-type mice on this background responded similarly to HgCl2 injury compared with wild-type mice on the C57BL/6 background. As indicated in Figure 2A, peak BUN values after HgCl2 administration were numerically but not statistically higher in mice with the C57BL/6JEixC3H/HeSnJ/CD-1 background, and functional recovery was indistinguishable between the two groups. All subsequent studies used wild-type mice on the C57BL/6JEixC3H/HeSnJ/CD-1 background as controls, which are designated as wt.



View larger version (13K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Recovery of renal function after induction of mercuric chloride nephrotoxicity. (A) Comparison of blood urea nitrogen (BUN) levels in wt mice on C57/BL6 (n = 6) and C57BL/6JEixC3H/HeSnJ/CD-1 (n = 10) backgrounds. (B) Comparison of BUN levels in wt and wa-2 mice (n = 20 to 25 in each group; *P < 0.0001). (C) Comparison of serum creatinine levels in wt and wa-2 mice (n = 5 at each time point; *P < 0.001).

 
To ensure that differences in kidney recovery between wt and wa-2 were not the result of differences in mercury uptake or accumulation, we measured kidney mercury levels by cold vapor atomic absorption in a subset of mice. As expected, control tissue mercury levels were almost undetectable (wt versus wa-2: 0.17 versus 0.21 ppm). Twenty-four hours after mercuric chloride administration, kidney mercury levels were dramatically higher in both groups and were actually statistically higher in the wild-type mice (wt versus wa-2: 243 ± 13 versus 181 ± 17 ppm; n = 5; P < 0.02).

Baseline BUN levels were identical in wt and wa-2 mice (28 ± 2 versus 26 ± 1 mg/dl; n = 18; NS). Furthermore, the increases in BUN 1 d after administration of mercuric chloride were similar in wa-2 and wt (59 ± 4 versus 59 ± 3 mg/dl; Figure 2B). In contrast to the rapid decline in BUN in wt, wa-2 demonstrated significantly delayed declines in BUN levels (day 6: 80 ± 14 versus 30 ± 2 mg/dl; n = 20 to 25; P < 0.0001; Figure 2B). Increases in serum creatinine 1 d after mercuric chloride administration were also similar in wa-2 and wt (1.7 ± 0.2 versus 1.0 ± 0.1 mg/dl; n = 5; NS), but the levels were significantly elevated in wa-2 compared with wt on day 3 (3.7 ± 0.4 versus 1.8 ± 0.2 mg/dl; P < 0.001) and day 5 (3.0 ± 0.4 versus 0.8 ± 0.1 mg/dl; P < 0.001; Figure 2C).

On the first day after mercuric chloride administration, pathologic changes common to both groups were seen predominantly in cortical and outer medullary regions of the kidney. Changes included interstitial edema, tubular dilation, sloughing of individual epithelial cells, and early regenerative changes (Figure 3). Sloughing of brush borders with tubular dilation was clearly evident in straight proximal tubules of outer medulla outer stripe. Intraluminal granular casts were frequently observed. A predominance of regenerating proximal tubule epithelial cells was present at later time points. No significant pathologic changes were observed within glomeruli. Significant differences between wa-2 and wt mice were evident by posttreatment day 3. Regenerating tubular cells were predominant in wt animals, whereas significant epithelial cell damage without regeneration was still present in wa-2 animals. By day 5 posttreatment, minor early tubular regenerative changes could also be seen in wa-2 animals. Quantification of tubular injury showed comparable degrees of injury on day 1 (wa-2 versus wt: 1.7 ± 0.2 versus 1.5 ± 0.2), whereas on day 3 and day 5, renal tubule injury was increased in wa-2 versus wt (1.9 ± 0.1 versus 1.2 ± 0.1 [P < 0.01]; and 1.5 ± 0.2 versus 0.8 ± 0.03 [P < 0.01]), respectively (Figure 4A).



View larger version (103K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. Effects of mercuric chloride administration on kidney histology in wt and wa-2 mice. (A) 4x. (B) 20x. At day 1, significant proximal tubular injury was seen in both wt and wa-2 mice. Whereas wt mice showed significant repair of tubular epithelial cells on days 3 and 5, this process was markedly delayed in wa-2 mice.

 


View larger version (11K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Indices of injury and recovery in wt and wa-2 mice. (A) Tubule injury index was significantly increased in wa-2 mice on days 3 and 5. (B) TdT-mediated dUTP nick-end labeling (TUNEL) staining was increased in wa-2 mice at days 1, 3, and 5. (C) Bromodeoxyuridine (BrdU) incorporation showed significant augmentation on day 3 in wt compared with wa-2 mice (*P < 0.01; see Materials and Methods).

 
Significantly higher numbers of TUNEL-positive proximal tubular cells were detected in wa-2 compared with wt mice (1.8 ± 0.13 versus 1 ± 0.03; P < 0.01) at day 1 after mercuric chloride administration. In wt, the number of TUNEL-positive tubular epithelial cells declined at day 3 in wt (0.5 ± 0.02) and was almost undetectable by day 5 (0.2 ± 0.02). In contrast, the number of TUNEL-positive proximal tubular cells continued to increase in wa-2 at day 3 (2.2 ± 0.25; P < 0.01 versus wt) and was still significantly elevated at day 5 (1.3 ± 0.15; P < 0.01; Figures 4B and 5Go).



View larger version (173K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. TUNEL staining 3 d (A and B) and 5 d (C and D) after mercuric chloride administration in wt (A and C) and wa-2 (B and D) mice. TUNEL staining was markedly increased in cortical regions of wa-2 mice on days 3 and 5 compared with wt mice.

 
Compared with baseline, BrdU incorporation into tubular epithelial cells was significantly decreased in both wt and wa-2 on the first day after HgCl2 administration (Figure 4C). On day 3, increased BrdU incorporation was seen predominantly in cortical proximal tubule cells in both groups, but the number of BrdU-positive cells was markedly greater in the wild-type compared with control (17.7- versus 3.4-fold untreated mice; P < 0.01; Figure 6). By day 5, BrdU incorporation returned to baseline levels in both wt and wa-2 mice.



View larger version (116K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. BrdU incorporation 3 d after mercuric chloride administration in wt (A) and wa-2 (B) mice. Proximal tubule epithelial cells showed increased BrdU incorporation on day 3 after injection in wt mice compared with wa-2 mice.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In the mammalian kidney, the tubular epithelial cells are susceptible to injury by various agents, including ischemia/reperfusion and toxins. In response to acute injury, tubule cells undergo both necrosis and apoptosis, as well as altered cell/cell and cell/matrix interactions. Acute sublethal tubular injury disrupts cell polarity and alters integrin receptor distribution.

Toxic tubular injury by mercuric chloride has been studied extensively. The most prominent site of injury is the distal pars recta of proximal tubule. However, depending on the severity of injury, the entire length of the pars recta can be involved (19,20). Light microscopic changes of early mercury toxicity in the proximal tubule become apparent within 6 to 8 h, whereas evidence of epithelial cell necrosis is seen clearly after 12 h. With more severe injury, evidence of distal nephron segment injury is also seen, although it is still unclear whether injury to more distal segments represents direct toxic injury by mercury or is a secondary response as a result of the severe proximal injury (19).

To examine the role of EGFR in recovery from acute tubular injury, we used the wa-2 mouse model. Mice with targeted deletions of EGFR have severe developmental defects and, depending on the genetic background, either manifest fetal lethality or succumb within a few weeks after birth (21). In contrast, wa-2 have normal expression of EGFR, with a point mutation in the EGFR tyrosine kinase domain that results in approximately 90% decrease in kinase activity. EGF binding parameters are unchanged, although receptor endocytosis after ligand binding is somewhat delayed (22). These mice exhibit a relatively mild phenotype at baseline, consisting of a wavy first coat of fur, curled vibrissae and curved guard hairs, and a minor impairment of lactation (12). The phenotype is similar to wa-1 mice (a spontaneous mutation of the TGF-{alpha} gene, as well as TGF-{alpha} knockout mice (23–25)).

The major finding of the present study was that after acute tubular injury by HgCl2, wa-2 animals showed significantly slower and less complete recovery, indicating an important role for EGFR in the epithelial regenerative process. In untreated animals, the anatomy and histology and baseline functions of wa-2 kidneys were not significantly different from those in wt animals. Furthermore, the extent of injury in the initial phase after HgCl2 treatment was similar. However, compared with wt, wa-2 exhibited a striking delay in recovery from proximal tubular injury with increased persistence of TUNEL-positive cells and a delayed and diminished degree of BrdU incorporation. These findings indicate a reduced regenerative capacity and persistence of cell death after mercury toxicity in wa-2 mice compared with wt animals. Functional recovery assessment, determined by serum creatinine and BUN levels, further indicated impaired recovery capabilities in wa-2 animals compared with wt mice.

The family of growth factors that activate EGFR includes EGF, TGF-{alpha}, heparin-binding epidermal growth factor–like growth factor (HB-EGF), amphiregulin, betacellulin, cripto, and epiregulin. EGF receptors are widely distributed in the kidney, both in the glomerulus and along the basolateral membranes of the tubular epithelium (26,27). After acute tubular injury, 125I-EGF binding and EGF receptor mRNA expression increase (28,29), and there is evidence for EGFR activation after ischemia/reperfusion injury to the kidney (7,8). After either ischemic renal injury or nephrotoxic tubular injury in the rat, subcutaneous injection of EGF or TGF-{alpha} significantly accelerates [3H]thymidine incorporation and recovery of tubular function (9–11,30).

EGF was originally detected in mouse submaxillary glands (31). Although levels of EGF are high in saliva, circulating blood levels are low (32). EGF is also expressed at high levels in mammalian kidneys (33). EGF production in the adult mouse kidney has been localized to the thick ascending limb/distal convoluted tubule (33). After either ischemic or nephrotoxic injury, both preproEGF mRNA levels and urinary EGF levels decrease and remain significantly depressed for up to 7 d (28,34), although it has been reported that there is increased processing of preproEGF to its soluble, active form in response to acute ischemic renal injury (35). In addition, HB-EGF expression has been shown to increase significantly in rat kidney in response to acute tubular injury induced by mercuric chloride, ischemia, aminoglycosides, or folic acid (4–6). TGF-{alpha} expression also increases in response to folic acid nephrotoxicity (4).

A proposed paradigm for recovery from acute renal injury is that the postischemic tubule recapitulates certain aspects of renal development (36), and there is evidence suggesting a role for EGFR and its ligands in renal development. Both number and tyrosine phosphorylation of EGF receptors increase in the developing kidney during late fetal development, at the time that tubulogenesis and glomerulogenesis occur (37,38). HB-EGF is also highly expressed in the metanephric kidney (6,39). Administration of tyrosine kinase inhibitors, EGF receptor blocking antibodies, or anti–TGF-{alpha} antibodies to metanephric cultures all block differentiation of the structures arising from the ureteric bud (40,41). In vitro studies have suggested that HB-EGF can modulate tubulogenesis in NRK and cultured ureteric bud cells (39,42). Furthermore, homozygous mice engineered with a targeted disruption of the EGFR have evidence of abnormalities in differentiation of structures derived from ureteric bud (21).

In addition to roles as mitogens, EGF-like growth factors may be cytoprotective for the kidney. EGF administration decreases apoptotic cell death in the nephrogenic zone of the developing kidney cortex and in the developing medullary papilla (43,44). Expression of membrane-associated HB-EGF prevents apoptosis in cultured renal epithelial cells (45,46).

In summary, the present studies provide clear evidence that normally functioning EGFR activity is necessary for recovery after acute injury to renal tubules. These results both confirm the general hypothesis that endogenous growth factor receptor activation is an important component of the response to acute renal injury and specifically indicate that the EGFR axis plays an essential role in tubule repair and regeneration.


   Acknowledgments
 
This work was supported by National Institutes of Health Grant DK51265 (R.C.H.), DK 59975 (G.M.), the Vanderbilt NIDDK Biotechnology Center (5U24DK058749), and funds from the Department of Veterans Affairs (R.C.H.).


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bonventre JV: Pathogenetic and regenerative mechanisms in acute tubular necrosis. Kidney Blood Press Res 21: 226–229, 1998[CrossRef][Medline]
  2. Harris RC: Growth factors and cytokines in acute renal failure. Adv Ren Replace Ther 4: 43–53, 1997[Medline]
  3. Toback FG: Regeneration after acute tubular necrosis. Kidney Int 41: 226–246, 1992[Medline]
  4. Hise MK, Salmanullah M, Liu L, Drachenberg CI, Papadimitriou JC, Rohan RM: Control of the epidermal growth factor receptor and its ligands during renal injury. Nephron 88: 71–79, 2001[CrossRef][Medline]
  5. Homma T, Sakai M, Cheng HF, Yasuda T, Coffey RJ Jr, Harris RC: Induction of heparin-binding epidermal growth factor-like growth factor mRNA in rat kidney after acute injury. J Clin Invest 96: 1018–1025, 1995
  6. Sakai M, Zhang M, Homma T, Garrick B, Abraham JA, McKanna JA, Harris RC: Production of heparin binding epidermal growth factor-like growth factor in the early phase of regeneration after acute renal injury. Isolation and localization of bioactive molecules. J Clin Invest 99: 2128–2138, 1997[Medline]
  7. Yano T, Yazima S, Hagiwara K, Ozasa H, Ishizuka S, Horikawa S: Activation of epidermal growth factor receptor in the early phase after renal ischemia-reperfusion in rat. Nephron 81: 230–233, 1999[CrossRef][Medline]
  8. Lin JJ, Cybulsky AV, Goodyer PR, Fine RN, Kaskel FJ: Insulin-like growth factor-1 enhances epidermal growth factor receptor activation and renal tubular cell regeneration in postischemic acute renal failure. J Lab Clin Med 125: 724–733, 1995[Medline]
  9. Humes HD, Cieslinski DA, Coimbra T, Messana J, Calvao C: Epidermal growth factor enhances renal tubule cell regeneration and repair and accelerates the recovery of renal function in postischemic acute renal failure. J Clin Invest 84: 1757–1765, 1989
  10. Norman JT, Tsau YK, Bacay A, Fine LG: Epidermal growth factor accelerates functional recovery from ischaemic acute tubular necrosis in the rat: Role of the epidermal growth factor receptor. Clin Sci 78: 445–450, 1990[Medline]
  11. Miller SB, Martin DR, Kissane J, Hammerman MR: Insulin-like growth factor I accelerates recovery from ischemic acute tubular necrosis in the rat. Proc Natl Acad Sci U S A 89: 11876–11880, 1992[Abstract/Free Full Text]
  12. Fowler KJ, Walker F, Alexander W, Hibbs ML, Nice EC, Bohmer RM, Mann GB, Thumwood C, Maglitto R, Danks JA, et al.: A mutation in the epidermal growth factor receptor in waved-2 mice has a profound effect on receptor biochemistry that results in impaired lactation. Proc Natl Acad Sci U S A 92: 1465–1469, 1995[Abstract/Free Full Text]
  13. Luetteke NC, Phillips HK, Qiu TH, Copeland NG, Earp HS, Jenkins NA, Lee DC: The mouse waved-2 phenotype results from a point mutation in the EGF receptor tyrosine kinase. Genes Dev 8: 399–413, 1994[Abstract/Free Full Text]
  14. Roberts R, Min L, Washington M, Olsen S, Settle SH, Coffey RJ, Threadgill DW: Importance of epidermal growth factor receptor signaling in establishment of adenomas and maintenance of carcinomas during intestinal tumorigenesis. Proc Natl Acad Sci U S A 99: 1521–1526, 2002[Abstract/Free Full Text]
  15. McKanna JA, Chuncharunee A, Munger KA, Breyer JA, Cohen S, Harris RC: Localization of p35 (annexin I, lipocortin I) in normal adult rat kidney and during recovery from ischemia. J Cell Physiol 153: 467–476, 1992[CrossRef][Medline]
  16. Miyaji T, Hu X, Star R: {alpha}-Melanocyte-simulating hormone and interleukin-10 do not protect the kidney against mercuric chloride-induced injury. Am J Physiol Renal Physiol 282: F795–F801, 2002[Abstract/Free Full Text]
  17. Satoh M, Nishimura N, Kanayama Y, Naganuma A, Suzuki T, Tohyama C: Enhanced renal toxicity by inorganic mercury in metallothionein-null mice. J Pharmacol Exp Ther 283: 1529–1533, 1997[Abstract/Free Full Text]
  18. Tanaka-Kagawa T, Suzuki M, Naganuma A, Yamanaka N, Imura N: strain difference in sensitivity of mice to renal toxicity of inorganic mercury. J Pharmacol Exp Ther 285: 335–341, 1998[Abstract/Free Full Text]
  19. Zalups RK: Molecular interactions with mercury in the kidney. Pharmacol Rev 52: 113–143, 2000[Abstract/Free Full Text]
  20. Diamond GL, Zalups RK: Understanding renal toxicity of heavy metals. Toxicol Pathol 26: 92–103, 1998[Medline]
  21. Threadgill DW, Dlugosz AA, Hansen LA, Tennenbaum T, Lichti U, Yee D, LaMantia C, Mourton T, Herrup K, Harris RC, et al.: Targeted disruption of mouse EGF receptor: Effect of genetic background on mutant phenotype. Science 269: 230–234, 1995[Abstract/Free Full Text]
  22. Keegan BP, Sheflin LG, Spaulding SW: The internalization and endosomal trafficking of the EGF receptor in response to EGF is delayed in the waved-2 mouse liver. Biochem Biophys Res Commun 267: 881–886, 2000[CrossRef][Medline]
  23. Mann GB, Fowler KJ, Gabriel A, Nice EC, Williams RL, Dunn AR: Mice with a null mutation of the TGF alpha gene have abnormal skin architecture, wavy hair, and curly whiskers and often develop corneal inflammation. Cell 73: 249–261, 1993[CrossRef][Medline]
  24. Luetteke NC, Qiu TH, Peiffer RL, Oliver P, Smithies O, Lee DC: TGF alpha deficiency results in hair follicle and eye abnormalities in targeted and waved-1 mice. Cell 73: 263–278, 1993[CrossRef][Medline]
  25. Berkowitz EA, Seroogy KB, Schroeder JA, Russell WE, Evans EP, Riedel RF, Phillips HK, Harrison CA, Lee DC, Luetteke NC: Characterization of the mouse transforming growth factor alpha gene: Its expression during eyelid development and in waved 1 tissues. Cell Growth Differ 7: 1271–1282, 1996[Abstract]
  26. Breyer MD, Redha R, Breyer JA: Segmental distribution of epidermal growth factor binding sites in rabbit nephron. Am J Physiol 259: F553–F558, 1990
  27. Harris RC, Daniel TO: Epidermal growth factor binding, stimulation of phosphorylation, and inhibition of gluconeogenesis in rat proximal tubule. J Cell Physiol 139: 383–391, 1989[CrossRef][Medline]
  28. Safirstein R, Price PM, Saggi SJ, Harris RC: Changes in gene expression after temporary renal ischemia. Kidney Int 37: 1515–1521, 1990[Medline]
  29. Behrens MT, Corbin AL, Hise MK: Epidermal growth factor receptor regulation in the rat kidney: Two models of renal growth. Am J Physiol 257: F1059–F1065, 1989
  30. Coimbra TM, Cieslinski DA, Humes HD: Epidermal growth factor accelerates renal repair in mercuric chloride nephrotoxicity. Am J Physiol 259: F438–F443, 1990
  31. Cohen S: Isolation of a mouse submaxillary gland protein accelerating incisor eruption and eyelid opening in the new-born animal. J Biol Chem 237: 1555–1562, 1962[Free Full Text]
  32. Carpenter GCS: Epidermal growth factor. Ann Rev Biochem 48: 193–230, 1979[CrossRef][Medline]
  33. Rall LB, Scott J, Bell GI, Crawford RJ, Penshcow JD, Niall HD, Coghlan JP: Mouse prepro-epidermal growth factor synthesis by the kidney and other tissues. Nature 313: 228, 1985[CrossRef][Medline]
  34. Verstrepen WA, Nouwen EJ, Zhu MQ, Ghielli M, De Broe ME: Time course of growth factor expression in mercuric chloride acute renal failure. Nephrol Dial Transplant 10: 1361–1371, 1995[Abstract/Free Full Text]
  35. Schaudies RP, Johnson JP: Increased soluble EGF after ischemia is accompanied by a decrease in membrane-associated precursors. Am J Physiol 264: F523–F531, 1993
  36. Witzgall R, Brown D, Schwarz C, Bonventre JV: Localization of proliferating cell nuclear antigen, vimentin, c-Fos, and clusterin in the postischemic kidney. Evidence for a heterogenous genetic response among nephron segments, and a large pool of mitotically active and dedifferentiated cells. J Clin Invest 93: 2175–2188, 1994
  37. Goodyer PR, Fata J, Mulligan L, Fischer D, Fagan R, Guyda HJ, Goodyer CG: Expression of transforming growth factor-alpha and epidermal growth factor receptor in human fetal kidneys. Mol Cell Endocrinol 77: 199–206, 1991[CrossRef][Medline]
  38. Cybulsky AV, Goodyer PR, McTavish AJ: Epidermal growth factor receptor activation in developing rat kidney. Am J Physiol 267: F428–F436, 1994
  39. Takemura T, Hino S, Okada M, Murata Y, Yanagida H, Ikeda M, Yoshioka K, Harris RC: Role of membrane-bound heparin-binding epidermal growth factor-like growth factor (HB-EGF) in renal epithelial cell branching. Kidney Int 61: 1968–1979, 2002[CrossRef][Medline]
  40. Rogers SA, Ryan G, Hammerman MR: Metanephric transforming growth factor-alpha is required for renal organogenesis in vitro. Am J Physiol 262: F533–F539, 1992
  41. Pugh JL, Sweeney WE Jr, Avner ED: Tyrosine kinase activity of the EGF receptor in murine metanephric organ culture. Kidney Int 47: 774–781, 1995[Medline]
  42. Takemura T, Hino S, Kuwajima H, Yanagida H, Okada M, Nagata M, Sasaki S, Barasch J, Harris RC, Yoshioka K: Induction of collecting duct morphogenesis in vitro by heparin-binding epidermal growth factor-like growth factor. J Am Soc Nephrol 12: 964–972, 2001[Abstract/Free Full Text]
  43. Coles HS, Burne JF, Raff MC: Large-scale normal cell death in the developing rat kidney and its reduction by epidermal growth factor. Development 118: 777–784, 1993[Abstract]
  44. Koseki C, Herzlinger D, al-Awqati Q: Apoptosis in metanephric development. J Cell Biol 119: 1327–1333, 1992[Abstract/Free Full Text]
  45. Takemura T, Kondo S, Homma T, Sakai M, Harris RC: The membrane-bound form of heparin-binding epidermal growth factor-like growth factor promotes survival of cultured renal epithelial cells. J Biol Chem 272: 31036–31042, 1997[Abstract/Free Full Text]
  46. Takemura T, Hino S, Murata Y, Yanagida H, Okada M, Yoshioka K, Harris RC: Coexpression of CD9 augments the ability of membrane-bound heparin-binding epidermal growth factor-like growth factor (proHB-EGF) to preserve renal epithelial cell viability. Kidney Int 55: 71–81, 1999[Medline]
Received for publication May 14, 2003. Accepted for publication September 7, 2003.




This article has been cited by other articles:


Home page
 HypertensionHome page
W. B.W.H. Melenhorst, G. M. Mulder, Q. Xi, J. G.J. Hoenderop, K. Kimura, S. Eguchi, and H. van Goor
Epidermal Growth Factor Receptor Signaling in the Kidney: Key Roles in Physiology and Disease
Hypertension, December 1, 2008; 52(6): 987 - 993.
[Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
I. Arany, A. Faisal, Y. Nagamine, and R. L. Safirstein
p66shc Inhibits Pro-survival Epidermal Growth Factor Receptor/ERK Signaling during Severe Oxidative Stress in Mouse Renal Proximal Tubule Cells
J. Biol. Chem., March 7, 2008; 283(10): 6110 - 6117.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
S. Zhuang, G. R. Kinsey, K. Rasbach, and R. G. Schnellmann
Heparin-binding epidermal growth factor and Src family kinases in proliferation of renal epithelial cells
Am J Physiol Renal Physiol, March 1, 2008; 294(3): F459 - F468.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
J. Lechner, N. A. Malloth, P. Jennings, D. Heckl, W. Pfaller, and T. Seppi
Opposing roles of EGF in IFN-{alpha}-induced epithelial barrier destabilization and tissue repair
Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1843 - C1850.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
S. Zhuang, Y. Yan, R. A. Daubert, and R. G. Schnellmann
Epiregulin promotes proliferation and migration of renal proximal tubular cells
Am J Physiol Renal Physiol, July 1, 2007; 293(1): F219 - F226.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
D. Chansel, M. Ciroldi, S. Vandermeersch, L. F Jackson, A.-M. Gomez, D. Henrion, D. C. Lee, T. M. Coffman, S. Richard, J.-C. Dussaule, et al.
Heparin binding EGF is necessary for vasospastic response to endothelin
FASEB J, September 1, 2006; 20(11): 1936 - 1938.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
U. Haussler, G. von Wichert, R. M. Schmid, F. Keller, and G. Schneider
Epidermal growth factor activates nuclear factor-{kappa}B in human proximal tubule cells
Am J Physiol Renal Physiol, October 1, 2005; 289(4): F808 - F815.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
M. C. Korrapati, E. A. Lock, and H. M. Mehendale
Molecular mechanisms of enhanced renal cell division in protection against S-1,2-dichlorovinyl-L-cysteine-induced acute renal failure and death
Am J Physiol Renal Physiol, July 1, 2005; 289(1): F175 - F185.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
S. Zhuang, Y. Dang, and R. G. Schnellmann
Requirement of the epidermal growth factor receptor in renal epithelial cell proliferation and migration
Am J Physiol Renal Physiol, September 1, 2004; 287(3): F365 - F372.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, Z.
Right arrow Articles by Harris, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Z.
Right arrow Articles by Harris, R. C.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP