WNK1, a Gene within a Novel Blood Pressure Control Pathway, Tissue-Specifically Generates Radically Different Isoforms with and without a Kinase Domain
Michelle O’Reilly*,
Elaine Marshall*,
Helen J.L. Speirs* and
Roger W. Brown*
*Molecular Endocrinology, University of Edinburgh, Edinburgh, Scotland.
Correspondence to Dr. Roger W. Brown, Molecular Medicine Centre, Western General Hospital, Edinburgh, EH4 2XU, United Kingdom. Phone: 0044-131-651-1024/1037; Fax: 0044-131-651-1085;
ABSTRACT. WNK1 is a member of a novel serine/threonine kinasefamily, With-No-K, (lysine). Intronic deletions in the encodinggene cause Gordon syndrome, an autosomal dominant, hypertensive,hyperkalemic disorder particularly responsive to thiazide diuretics,a first-line treatment in essential hypertension. To elucidatethe novel WNK1 BP control pathway active in distal nephron,WNK1 expression in mouse was studied. It was found that WNK1is highly expressed in testis > heart, lung, kidney, placenta> skeletal muscle, brain, and widely at low levels. SeveralWNK1 transcript classes are demonstrated, showing tissue-, developmental-,and nephron-segment–specific expression. Importantly,in kidney, the most prominent transcripts are smaller than elsewhere,having the first four exons replaced by an alternative 5'-exon,deleting the kinase domain, and showing strong distal nephronexpression, whereas larger transcripts show low-level widespreaddistribution. Alternative splicing of exons 11 and 12 is prominent—forexample, transcripts containing exon 11 are abundant in neuraltissues, testis, and secondary renal transcripts but are predominantlyabsent in placenta. The transcriptional diversity generatedby these events would produce proteins greatly differing inboth structure and function. These findings help further defineand clarify the role of WNK1 and the thiazide-responsive pathwayrelevant to essential hypertension in which it participates.E-mail: Roger.Brown@ed.ac.uk
Gordon syndrome (also known as pseudohypoaldosteronism type2, PHA 2; Online Mendelian Inheritance in Man 145260) is a familialform of hypertension with an autosomal dominant mode of inheritance(1). Patients have suppressed plasma renin activity and presentwith symptoms of severe hypertension (attributed to increasedrenal Na+ reabsorption), hyperkalemia (despite normal glomerularfiltration), and metabolic acidosis as a result of reduced renalK+ and H+ excretion, respectively (2). These features are chloridedependent and are particularly well ameliorated by administrationof thiazide diuretics (2–4). In common with other chloridetransport–related disorders affecting BP, such as Barttersyndrome (5,6), it seemed possible that the etiology lay ina direct mutation in a chloride channel subunit or transporter(7).
However, mutations in human WNK1 and WNK4 genes have recentlybeen associated with Gordon syndrome (8). The encoded proteinsof these genes are described as members of a novel family ofserine/threonine kinases known as WNK (With No K, lysine) becauseof the atypical positioning of a conserved lysine residue withinthe catalytic domain (9). How they relate to ion transport abnormalitiesis of key importance as this seems to represent a novel BP regulatorypathway (10–12). Moreover, intriguingly, cases attributedto WNK1 mutations in this autosomal dominant disorder are dueto intronic deletions and are not recognized as directly affectingWNK1 coding sequence (8).
It is of great interest how such WNK1 mutations, in a widelyexpressed gene, cause an autosomal dominant disease, with amechanism seemingly explicable by a distal nephron–limitedion transport defect (2,13). One possibility sees the intronicregion involved in transcriptional regulation, and some preliminaryevidence maintains this as a reasonable explanation. Alternatively,this apparently "silent" mutation may alter the complement ofspliced products transcribed from the gene. Such silent mutationshave been shown to cause dominant diseases by altering splicing,e.g., in the fibrillin-1 gene, causing Marfan syndrome (14).Thus, evidence relating to promoter use and alternative splicingof WNK1, especially relating to kidney, is of interest.
The study presented here describes, in some detail, severalisoforms produced from the WNK1 gene, some of which show strikinglydifferent tissue-specific distributions, including one showingabundant expression in kidney that is seen at low level, ifat all, in other tissues. Such modifications, generating thistranscriptional diversity, also produce predicted proteins ofvery different structure and proposed function. The findingsreported thus help elucidate not only probable mechanisms bywhich the WNK1 intronic deletions cause disease, but also furtherclarify the novel WNK1 BP control pathway.
Northern Blot Analysis
Total RNA was extracted in TRIzol Reagent (Invitrogen, Inchinnan,UK) and separated (15 µg/lane) by denaturing (formamide/formaldehyde)agarose electrophoresis (0.8%), and blotted onto Hybond-N+ membrane(Amersham Biosciences, Little Chalfont, UK). Blots were hybridizedwith PCR-amplified mouse WNK1 (mWNK1) DNA fragments, radiolabeledwith 32P-dCTP (Rediprime II Random Prime Labeling System, AmershamBiosciences, UK), at 65°C overnight in hybridization buffer(0.5 M Na2PO4·NaH2PO4 pH 7.2/7% SDS with 100 µg/mldenatured salmon sperm and 20 µg/ml yeast tRNA). Washeswere at 65°C with 50 mM Na2PO4·NaH2PO4 pH 7.2/1%SDS. Blots were exposed to Kodak x-ray film (BioMax MS-1; Sigma,Poole, UK) at -70°C. cDNA templates for Northern blot probeproduction were PCR amplified with primers as detailed in Table 1and Figures 1 and 2.
Figure 1. Schematic representation of WNK1 cDNA structure showing primer positions. (a and b) cDNA structure of WNK1 and kidney-specific WNK1 containing exon 4A, respectively, with vertical bars representing splice junctions and dashed vertical bars indicating 3' polyadenylation sites A1 and A2. Numbers within rectangles refer to exon numbers. Primers are represented by arrows and are numbered P1 to P28. Additional primer details are given in Table 1. Horizontal dashed lines specify the cDNA region amplified by PCR with the corresponding primer pairs. (c) cDNA sequence of exon 4A (accession no. AY319934). The predicted amino acid sequence also shown would continue in frame across the splice site to exon 5.
Figure 2. Northern blot analysis of WNK1 expression. Hybridization with a probe incorporating exons 6 to 9 (a) detects widespread expression of large transcripts approximately 10.2 kb in size. In addition, smaller and more prominent transcripts are detected in kidney. This expression profile is also observed in (b) when hybridizing with the poly-A probe (refers to sequence located between the two 3' polyadenylation signals A1 and A2). (c) Probing with exon 1 fails to detect the smaller kidney-specific transcripts. (d) Northern blot analysis reveals differential expression of individual exons in WNK1 isoforms in kidney (K) and testis (T). Hybridization with probes against exons 2, 3, 4, 5, and 6 detect the large WNK1 isoform, strongly in testis but weakly in kidney. The smaller and more abundant kidney-specific isoform is only detected by probes to exons 5 and 6. A probe to an alternative exon, 4A, detects the smaller kidney-specific isoform only. Hybridization with a probe to exon 11 detects the large WNK1 isoform in testis but signal is low for either isoform in kidney. In contrast, hybridization with exon 12 readily detects both the kidney-specific isoform and the large WNK1 testis isoform. WNK1 expression was studied across a range of adult mouse tissues and in placenta (E16.5). Probe templates were PCR amplified with the following primer pairs: exons 6 to 9, P5/P6 (860 bp); poly-A, P3/P4 (875 bp); exon 1, P1/P2 (928 bp); exon 2, P15/P16 (180 bp); exon 3, P17/P18 (187 bp); exon 4, P19/P20 (161 bp); exon 4A, P9/P10 (340 bp); exon 5, P21/P22 (96 bp); exon 6, P23/P24 (212 bp); exon 11, P25/P26 (462 bp); and exon 12, P27/P28 (278 bp). For primer positions and sequences, refer to Figure 1 and Table 1, respectively.
RT-PCR
Promega Reverse Transcription System (random primed) (Promega,Southampton, UK) generated PCR templates (5 µl, diluted1:20), used in standard PCR reactions, denaturing at 95°Cfor 3 min, then incubating on ice, and adding 15 pmol each primer,250 µmol dNTP, and 2 U Taq DNA Polymerase (Promega) toa final volume of 50 µl in 1x PCR buffer. The PCR programused was as follows: 3 min at 95°C, then 35 to 40 cyclesof 60 s at 95°C, 60 s at 60°C, 120 s at 72°C, andfinally 10 min at 72°C. For negative controls, templatewas replaced with water. Products were visualized by agarosegel electrophoresis and purified with QIAquick PCR PurificationKit (Qiagen, Crawley, UK).
Production of Single-Stranded RNA Probes
RNA probes for in situ hybridization (ISH) analysis, producedas described previously (15) to specific regions of mWNK1, useda nested PCR method with primers, including 5' extensions containingphage polymerase consensus sites, with sense and antisense primerpairs incorporating T3 (TCTAGATTAACCCTCACTAAAGGGA) and T7 (GGATCCTAATACGACTCACTATAGGG)sites, respectively. The PCR program used was as follows: 5cycles of 45 s at 95°C, 45 s at 55°C, 120 s at 72°C,followed by 30 cycles of 45 s at 95°C, 45 s at 69°C,and 120 s at 72°C, and finally 10 min at 72°C. The requiredDNA-dependent RNA phage polymerase (T3-sense, T7-antisense)was then used on these purified PCR products to produce single-stranded35S-UTP–labeled RNA probes of the corresponding insertsfor ISH, as described elsewhere (15).
ISH Analysis
ISH, as described previously (15,16), used cryostat sections(10 µm) cut from adult mouse kidney and mouse embryo samples(gestation day 16.5) mounted on silane-coated glass microscopicslides. Slides were fixed in 4% paraformaldehyde, incubatedwith prehybridization buffer at 50°C, hybridized with denatured35S-UTP–labeled RNA probes (at a final concentration ofapproximately 10x106 cpm/ml in hybridization buffer at 50°Cfor approximately 16 h), followed by washes in 2x SSC, treatmentwith RNase A, and further washes to a maximum stringency of0.1x SSC at 60°C. After ethanol series dehydration, slideswere exposed to Kodak x-ray film (BioMax MR-1; Sigma). Slideswere then emulsion dipped and exposed in a light-tight box for3 to 5 wk before being developed.
The mouse WNK1 gene (mWNK1) is large, spanning >100 kb, witha coding region showing 86% identity with human WNK1 (hWNK1).mWNK1 produces large transcripts (>10 kb) with cDNA encodedby 28 exons (Figure 1a), having a predicted 2377 amino acidprotein. Northern blot hybridization with exons 6 to 9 revealedwidespread distribution of these large transcripts (Figure 2a)with high expression seen in testis > heart, lung, kidney,placenta > skeletal muscle, brain, and low-level expressionelsewhere. Additional Northern blots show placental transcriptsare of similar size to the major widely found isoform. In kidney,a smaller, more abundant mWNK1 transcript is seen differingby at least 1.5 to 2 kb (Figure 2a). A 3'-polyadenylation (poly-A)site A1 (Figure 1) is positioned approximately 800 bp downstreamof the open reading frame (ORF). To assess whether the use ofan alternative poly-A site could account for this size difference,we isolated cDNA sequence encoding a second poly-A site approximately2400 bp downstream of the ORF (Figure 1, A2). Northern blothybridization with cDNA between these poly-A sites revealeda similar expression profile to that described above (Figure 2b).Both transcripts in kidney were detected implying mostWNK1 transcripts terminate at the second 3' poly-A site (Figure 1,A2). Having excluded this possibility, an exon 1 probe, overlappingthe ORF (Figure 1), was designed against the 5' region. Northernblot hybridization with exon 1 revealed a similar expressionprofile for the large mWNK1 transcript, but the smaller kidney-specifictranscript remained completely undetected, indicating it lacksexon 1 (Figure 2c).
To investigate whether this kidney-specific isoform lacked further5' exons, nested PCR was used to produce probes against exons2, 3, 4, 5, and 6 (Figure 1), ensuring amplification of mWNK1cDNA only (confirmed by sequencing) across this highly conservedkinase domain region. Northern blot analysis of kidney and testisRNA showed probes to exons 2, 3, and 4 only detect the largemWNK1 transcript and not the smaller kidney-specific isoform(Figure 2d). In contrast, exon 5 and 6 probes detect both mWNK1transcripts. Thus, the smaller mWNK1 transcript in kidney lacksexons 1 to 4. Screening submitted expressed sequence tag (EST)databases suggested an alternative exon preceding exon 5 inkidney, positioned between exons 4 and 5 in the genomic sequenceand therefore termed exon 4A. Northern blot hybridization withthis exon only detects the smaller mWNK1 transcript (Figure 2d),confirming inclusion of exon 4A in the kidney-specificisoform (Figure 1b).
ISH to exons 6 to 9 allowed detailed study of mWNK1 expressionin mouse kidney. Figure 3 reveals clear WNK1 expression abovebackground in distal nephron extending from early distal convolutedtubule (DCT) into connecting tubule and at lower level intocortical collecting duct (lower expression in medullary rays;Figure 3). Strong expression in DCT continues adjacent to glomeruliand is seen looping close to their vascular pole (Figure 3 rightpanels) the site of the macula densa. Additionally, lower expression,above background, is distributed more extensively. This appearsto have a different origin from the higher expression seen inDCT (i.e., different WNK1 transcripts; see below).
Figure 3. In situ hybridization (ISH) of WNK1 in mouse kidney. The ISH study used a probe to WNK1 exons 6 to 9. Images are of emulsion-dipped slides (eosin/cresyl violet counterstain; original magnification: left, x40; right, x200). View of renal cortex with a medullary ray (MR) demarcated between the parallel lines and cortical labyrinth lateral to them. Below the dashed line is the outer medulla. Bright field on top (black, strong expression), corresponding dark field view on bottom (white, expression). The very highest expression—showing black on bright field—obscures light, and hence the strongest expressing tubules appear as black holes with ring outlines on dark field view (bottom left). Short black arrows indicate glomeruli; a, examples of distal convoluted tubules (DCT) largely adjacent to glomeruli; b, example of connecting tubules (CNT) in midcortical labyrinth arcades (adjacent to radial vessels); c, cortical collecting duct (CCD) in medullary rays; and GA, glomerular arteriole. (left) Study with long exposure (5 wk) demonstrating wide range of expression level. Note regional expression at 3 levels: (1) widespread low level (low level white seen in darkfield), (2) higher in CCD (faint but distinct tubular outline seen on dark field, pale gray on bright field); and (3) highest in DCT and CNT (darker gray-black on bright field and bright ring with black hole center when silver grains confluent). (right) Three-week exposure: note the proximity of strongly expressing DCT to glomerulus and its vascular pole (between arterioles) and stronger expression than in collecting duct.
To investigate the distribution of the two kidney isoforms,adult kidney sections were hybridized with exons 1, 4A, and6 to 9 (Figure 4, top left panel). Probing with exon 1 detectswidespread signal at a low level (Figure 4a), whereas with exon4A, only strong punctate signal in cortex is detected (Figure 4c).The expression pattern seen with exons 6 to 9 is thus acombination of that seen with exons 1 and 4A (Figure 4e). Theseprobes were also hybridized to embryo tissue slices (E16.5)to examine developmental mWNK1 expression. Probing with exons6 to 9 revealed a wide mWNK1 distribution, with high expressionin tissues—for example, placenta, nasal epithelium, lung,intestine, regions of the brain, and developing renal cortex(Figure 4f). As expected, the expression patterns revealed byprobing with exons 1 and 4A were subtypes of that seen for exons6 to 9, with exon 1 widely expressed, particularly in placenta,lung, kidney, intestine, thymus, and forebrain (Figure 4b),whereas exon 4A revealed much lower expression, with high signaldetected in restricted regions (e.g., nasal epithelium, forebrain,thymus, and kidney; Figure 4d). Sense control sections showedno specific hybridization (Figure 4).
Figure 4. Analysis of WNK1 expression by in situ hybridization (ISH) of mouse adult kidney and fetal sections (E16.5). Cryostat sections were subjected to ISH analysis; a range of probes against WNK1 were used. Left columns of top panels show local distribution within the kidney (a, c, e, g, i, and k). Right columns of top panels show corresponding developmental expression patterns (b, d, f, h, j, and l). Bottom panel shows sense controls for both kidney (m and n) and fetal (o and p) sections. Probes were constructed against exon 1 (434 bp), exon 4A (280 bp), exons 6 to 9 (552 bp), exon 11 (460 bp), exon 12 (283 bp), and exon 4B (108 bp). Exposure times for detection of ISH signal were as follows: exon 1, (a and b) 1 d; exon 4A, (c) 1 d, (d) 4 d, (n) 1 wk; exon 6 to 9, (e and f) 1 d, (m) 3 d; exon 11, (g, h, and o) 3 d; exon 12, (i and j) 3 d; exon 4B, (k, l, and p), 2.5 wk. For details of probe lengths and production, see Materials and Methods. B indicates brain; K, kidney; L, lung; and P, placenta.
EST sequences suggest that alternative splicing of mWNK1, primarilyconcerning exons 11 and 12, takes place in some tissues (Figure 1).To investigate this, we subjected kidney and testis RNAto Northern blot analysis with probes specific for each exon.Hybridization with exon 11 detects the large mWNK1 isoform intestis, but signal is greatly diminished for either isoformin kidney (Figure 2d), suggesting exon 11 is usually splicedout in both kidney mWNK1 transcript classes. In contrast, hybridizationwith exon 12 shows strong signal for mWNK1 in testis and forthe smaller kidney-specific transcript. The large mWNK1 transcriptin kidney is also detected at a lower level (Figure 2d). Toinvestigate tissue-specific and developmental variations inthese splicing events, we subjected adult mouse kidney and fetal(E16.5) sections to ISH analysis. The expression patterns seenwhen probing adult kidney sections with either exon are similarto that described above for exons 6 to 9, showing low-level,widespread expression throughout the kidney, overlaid with strongpunctate cortical expression (Figure 4, g and i). However, developmentalexpression studies that use these probes indicate that althoughmany fetal tissues express both exons similarly, striking tissue-specificsplicing occurs in some developing organs. For example, transcriptscontaining exon 11 are abundant in some neural tissues but arerare or absent in placenta (Figure 4, h and j). Sense-controlsections showed no specific hybridization (Figure 4).
Reverse transcriptase–PCR (RT-PCR) studies across exons11 and 12 confirm these splicing events (Figure 5a). Amplificationin kidney by means of primers spanning the exon 7/8 splice sitedown to the exon 15/16 splice site shows two major bands, correspondingin size to PCR products having either exon 11, or both exons11 and 12 spliced out (Figure 5b). Additional RT-PCR studiesthat use alternative primers spanning this region also showmajor bands, similarly representative of these splice variants.However, it is difficult to interpret the importance of additionallarge weak products occasionally amplified by RT-PCR.
Figure 5. Detection of WNK1 alternative splicing. (a) Ethidium bromide–stained agarose gel, showing reverse transcriptase–PCR–amplified fragments in duplicate. These products were amplified with mWNK1 primer pair P7 and P8, which span a region from the exon 7/8 splice site down to the exon 15/16 splice site (lanes 3 and 4). A negative control is seen in lane 2. Lane 1 shows a 100-bp DNA ladder. (b) Schematic depiction of WNK1 alternative splicing involving exons 11 and 12. The major products seen correspond to (b) (iii) and (b) (iv). (c) Schematic representation of the major predicted WNK1-derived proteins. mWNK1 is 2377 amino acids in length and is particularly rich in serine, glutamine, and proline, having 26 PXXP sites potentially recognized by SH3 domains. Black bars denote four putative coiled coil domains, and a conserved WNK autoinhibitory domain is represented by horizontal stripes. Black arrowheads indicate the positions of all potential phosphorylation sites; intriguingly none of which overlap with the region encoded by exons 11 and 12. Exon 11 encodes a leucine zipper (LXXLL) motif. Kinase-deficient (KDP) WNK1 has a truncated N-terminus, lacking one coiled coil domain and deleting a major portion of the kinase domain. This region is substituted with a highly cysteine-rich stretch of 30 amino acids.
EST sequences also suggest that in addition to exons 4 and 4A,a third exon positioned between exons 4A and 5 in the mousegenomic sequence and therefore termed 4B, may precede exon 5in some mWNK1 transcripts (accession no. AK052468). The ESTevidence suggests that unlike the kidney-specific transcriptsdescribed above containing exon 4A, which lack all known upstreamexons, transcripts containing 4B splice directly from exon 4to 4B to 5. ISH analysis probing with exon 4B shows a similarpattern to that seen previously in kidney, with high corticalexpression overlaying a low widespread distribution (Figure 4k).However, splicing events producing transcripts containingexon 4B appear to be rare, judged by the lower ISH signal (requiringseveralfold longer for clear detection). Furthermore, signaldetected on fetal sections was low and widespread, lacking thestriking tissue-specific differences in expression levels seenwith probes to other exons (Figure 4l), and was only marginallyhigher than that seen for sense controls (Figure 4p).
As described above, Northern blot studies examining exon 11expression detect very weak signal for both isoforms in kidney,despite high expression in testis. In contrast, ISH studiessuggest exon 11 is expressed at levels comparable with exon12 in kidney. This discrepancy led to further Northern blotanalysis looking for evidence of further novel mWNK1 kidneytranscripts containing exon 11. These studies revealed at leasttwo novel mWNK1 transcripts in kidney and testis, evidentlyseveral kilobases smaller than the two isoforms described above(Figure 6). Intriguingly, transcripts of similar size were detectedin additional Northern blot analysis of exon 4A expression inboth tissues (Figure 6).
Figure 6. Detection of smaller WNK1 transcripts in kidney and testis by Northern blot (short exposure). Probes to exon 4A detect the kidney-specific WNK1 transcript (B), but also reveal two additional transcripts several kilobases smaller (C and D) in both kidney (K) and testis (T). These transcripts are also seen when probing with exon 11, which also detects the large WNK1 transcript (A) as expected.
In this study, we show multiple WNK1 mRNA species are expressedin both adult mouse and during development, with some showingstriking tissue-specific expression differences. Large transcripts—greaterthan 10 kb in size—were seen by Northern blot in virtuallyall tissues examined, with expression highest in testis >heart, lung, kidney, placenta > skeletal muscle, brain. Transcriptsdetected in testis appeared larger than transcripts common tomost other tissues, attributed to the inclusion of exon 11 (462bp). The major transcripts seen in kidney, however, were smallerthan elsewhere. This phenomenon has been reported in previousstudies (8) and appears to be conserved between species. Wehave demonstrated that the difference between these transcriptsis not the result of the use of an alternative 3' polyadenylationsite, as previously suggested (8,9,17,18). Instead, we showthat the first four exons in the smaller, more prominent kidneytranscripts are replaced by an alternative exon, exon 4A (19).The sequence of this novel exon and the resulting predictedamino acid sequence are presented for the first time (Figure 1c).ISH analysis revealed strong punctate expression of thesesmaller transcripts restricted to cortex, localizing to distalnephron, whereas the large transcripts showed uniform low-levelexpression throughout the kidney. These expression patternsare combined in that seen for exons 6 to 9, found in both transcriptclasses. In addition to exons 4 and 4A, another novel exon,exon 4B, was found to precede exon 5 in some WNK1 kidney transcripts;however, weak ISH signal suggests that this is a rare splicingevent.
Use of exon-specific primers identified two relatively abundant,alternatively spliced mWNK1 mRNAs in kidney, corresponding insize to transcripts lacking either exon 11 or both exon 11 and12. Alternative splicing of these exons has also been reportedfor hWNK1 (17). Furthermore, the published rat WNK1 sequence(accession no. NM_053794) corresponds to the splice variantlacking both exons. Exon-specific ISH detected expression inkidney, with probes to both exons showing a similar patternto that described above for exons 6 to 9. In contrast, Northernblot analysis showed that although exon 12 is usually includedin the small abundant kidney isoform, exon 11 is largely absentin both kidney isoforms. Further studies indicate the productionof substantial levels of novel smaller alternatively splicedtranscripts from the WNK1 gene, with Northern blot analysisimplicating the inclusion of both exons 11 and 4A. These smallertranscripts are seen in kidney but also in testis, a tissuein which exon 4A expression was previously unsuspected becausetestis lacks obvious expression of the much larger "kidney-specific"4A transcript. Preliminary investigations suggest that thesetranscripts differ from this largely kidney-specific 4A transcript,described above, being much smaller in size. However, RT-PCRin testis easily amplifies a product from exon 4A to exon 11,suggesting these smaller transcripts contain this region.
This study was the first to assess WNK1 expression in developmentby means of ISH analysis, demonstrating that WNK1 is widelyexpressed in the mouse embryo (E16.5), in both epithelial tissues(e.g., developing renal cortex, intestine, lung, nasal epithelia,and placenta) and in nonepithelial tissues (e.g., regions ofthe CNS). Again, there are tissue-specific differences in thepattern of transcripts expressed in developing organs, withtranscripts containing exon 1 showing high widespread but nonuniformexpression and exon 4A–containing transcripts showinghigh expression only in restricted sites. Exon-specific ISHalso showed striking tissue-specific differences in expressionof exons 11 and 12—for example, transcripts containingexon 11 are abundant in some neural tissues but are very lowor absent in placenta.
It is appropriate to suggest that WNK1 regulates ion transportthrough the kinase domain. However, the major WNK1 transcriptin kidney lacks this functional entity as a result of the replacementof exons 1 to 4 with exon 4A (Figure 5c). Additionally, a coiledcoil motif predicted just N-terminal to the kinase domain islost, possibly disrupting interactions with molecular targets.This implies that the remainder of the WNK1 protein must contributefunctionally to the WNK1 regulatory pathway. Exons 11 and 12are of key interest because splicing of this region is conservedbetween species, is clearly tissue specific, and would producea repertoire of proteins likely to be coexpressed in the sametissues and probably the same cells (Figure 4). The predictedamino acid sequence encoded by these exons is proline rich (approximately15%), and analysis suggests a potential transmembrane span flankedby a flexible conformation. This region also shows homologyto a number of extracellular matrix proteins (e.g., mucins,glycosaminoglycans, and sialoproteins). Clearly, this is ofinterest in the context of proteins that may play a role intight junction regulation. Conversely, when this stretch ofamino acids is removed, these features disappear. The resultingjuxtaposed sequence is predicted to form an exposed loop regionwith homology to proteins that tend to bind ligands and/or actas transcription factors. Intriguingly, although WNK1 containsnumerous potential phosphorylation sites, no such site occurswithin the exon 11 to 12 region, implying that signaling throughprotein kinase pathways acting on WNK1 is not affected by suchsplicing events. Clearly, experimental studies are requiredto fully investigate these possibilities.
Also of interest is the addition of thirty amino acids to theN-terminus of kinase-deficient (KDP) WNK1, contributed by exon4A. This exon may have no major functional effect other thandeleting the kinase domain. However, this sequence is strikinglycysteine rich. Within a cluster of six likely very reactivecysteine residues, at least three have a high predictive indexfor forming either disulfide bonds or bonds with other molecules(e.g., metal-containing moieties). Moreover, the N-terminalpositioning of this cysteine cluster may promote this regionas a potential point of anchorage to other structures. Furthermore,the novel small bands seen by Northern blot clearly indicatethe production of WNK1 transcripts lacking several kilobasescompared with the kidney-specific 4A band. Therefore, it isvery likely that additional changes in WNK1 protein structureexist that have profound effects on WNK1 function.
The transcriptional modifications described above would greatlyinfluence the potential complement of proteins produced fromthe WNK1 gene and may have evolved to regulate WNK1 function.KDP-WNK1 proteins may act to inhibit other WNK1 proteins, having"active" kinase domains, via interactions through the remainingcoiled-coil motifs (Figure 5c). This is supported by the recentreport of a WNK1 autoinhibitory domain, positioned between residues515 to 569 in the rat sequence, which is conserved between speciesand also within the WNK family (Figure 5c). Preliminary evidencewas also reported for WNK1 tetramer formation via the coiled-coilmotif C-terminal to the autoinhibitory domain (Figure 5c) (20).
This work provides a number of insights into the cause of Gordonsyndrome. We have examined WNK1 expression in some detail, furtherelucidating kidney-specific and distal-nephron–specificWNK1 transcripts. Our findings imply the use of alternativepromoters, one initiating transcription in exon 1 and the secondgiving rise to transcripts having exon 4A in place of exons1 to 4. It is therefore reasonable to suggest that cis elementswithin intron 1 affect the second promoter regulating such 4Atranscripts. Dominant negative regulation would imply that intronicdeletions causing Gordon syndrome lead to abnormally high expressionof KDP-WNK1 transcripts in kidney, in turn causing excessiveinhibition of "normal" WNK1 function. Alternatively, the intron1 deletions could interrupt splicing enhancer or silencer sequences,thereby affecting the inclusion or exclusion of exons and disruptingthe complement of alternatively spliced WNK1 transcripts. Asimilar effect is seen in Marfan syndrome, another autosomaldominant disorder affecting connective tissue, where a silentmutation results in exon skipping (14). In ataxia-telangiectasia,an intronic deletion in the ATM gene results in aberrant inclusionof a cryptic exon (21).
The pathway disrupted in Gordon syndrome involving WNK1 is regardedas different from other signaling pathways known to regulateBP. The findings presented here reveal the central importanceof the transcriptional control of this gene in generating acomplement of kidney-specific, WNK1-derived proteins. The correctbalance within this complement of proteins must mediate theeffects on ion transport that constitute this novel BP regulatorypathway. Clearly the regulation of alternative promoter useand splicing is likely to participate in the control of BP byWNK1-derived proteins.
Acknowledgments
We thank Susan K. Coan for her technical assistance, and wethank the Wellcome Trust (grant 065616; PhD Studentship to MOR)and the British Heart Foundation (grant PG2001075) for theirsupport.
Gordon RD: Syndrome of hypertension and hyperkalemia with normal glomerular filtration rate. Hypertension 8: 93–102, 1986[Free Full Text]
Gordon RD, Klemm SA, Tunny TJ, Stowasser M: Gordon’s syndrome: A sodium-volume–dependent form of hypertension with a genetic basis. In: Hypertension: Pathophysiology, Diagnosis, and Management, 2nd Ed., edited by Laragh JH, Brenner BM, New York, Raven Press, 1995, pp 2111–2123
Schambelan M, Sebastian A, Rector FC Jr: Mineralocorticoid-resistant renal hyperkalemia without salt wasting (type II pseudohypoaldosteronism): Role of increased renal chloride reabsorption. Kidney Int 19: 716–727, 1981[Medline]
Bonny O, Rossier BC: Disturbances of Na/K balance: Pseudohypoaldosteronism revisited. J Am Soc Nephrol 13: 2399–2414, 2002[Free Full Text]
Estevez R, Boettger T, Stein V, Birkenhager R, Otto E, Hildebrandt F, Jentsch TJ: Barttin is a Cl- channel beta-subunit crucial for renal Cl- reabsorption and inner ear K+ secretion [Comment]. Nature 414: 558–561, 2001[CrossRef][Medline]
Lifton RP, Gharavi AG, Geller DS: Molecular mechanisms of human hypertension. Cell 104: 545–556, 2001[CrossRef][Medline]
Hubner CA, Jentsch TJ: Ion channel diseases. Hum Mol Genet 11: 2435–2445, 2002[Abstract/Free Full Text]
Wilson FH, Disse-Nicodeme S, Choate KA, Ishikawa K, Nelson-Williams C, Desitter I, Gunel M, Milford DV, Lipkin GW, Achard JM, Feely MP, Dussol B, Berland Y, Unwin RJ, Mayan H, Simon DB, Farfel Z, Jeunemaitre X, Lifton RP: Human hypertension caused by mutations in WNK kinases. Science 293: 1107–1112, 2001[Abstract/Free Full Text]
Xu B, English JM, Wilsbacher JL, Stippec S, Goldsmith EJ, Cobb MH: WNK1, a novel mammalian serine/threonine protein kinase lacking the catalytic lysine in subdomain II. J Biol Chem 275: 16795–16801, 2000[Abstract/Free Full Text]
Rossier BC: Negative regulators of sodium transport in the kidney: Key factors in understanding salt-sensitive hypertension? J Clin Invest 111: 947–950, 2003[CrossRef][Medline]
Wilson FH, Kahle KT, Sabath E, Lalioti MD, Rapson AK, Hoover RS, Hebert SC, Gamba G, Lifton RP: Molecular pathogenesis of inherited hypertension with hyperkalemia: The Na-Cl cotransporter is inhibited by wild-type but not mutant WNK4. Proc Natl Acad Sci U S A 100: 680–684, 2003[Abstract/Free Full Text]
Meneton P, Oh YS, Warnock DG: Genetic renal tubular disorders of renal ion channels and transporters. Semin Nephrol 21: 81–93, 2001[CrossRef][Medline]
Liu W, Qian C, Francke U: Silent mutation induces exon skipping of fibrillin-1 gene in Marfan syndrome. Nat Genet 16: 328–329, 1997[CrossRef][Medline]
MacDonald P, MacKenzie S, Ramage LE, Seckl JR, Brown RW: Corticosteroid regulation of amiloride-sensitive sodium-channel subunit mRNA expression in mouse kidney. J Endocrinol 165: 25–37, 2000[Abstract]
Brown RW, Chapman KE, Kotelevtsev Y, Yau JL, Lindsay RS, Brett L, Leckie C, Murad P, Lyons V, Mullins JJ, Edwards CR, Seckl JR: Cloning and production of antisera to human placental 11 beta- hydroxysteroid dehydrogenase type 2. Biochem J 313 [Pt 3]: 1007–1017, 1996
Verissimo F, Jordan P: WNK kinases, a novel protein kinase subfamily in multi-cellular organisms. Oncogene 20: 5562–5569, 2001[CrossRef][Medline]
Choate KA, Kahle KT, Wilson FH, Nelson-Williams C, Lifton RP: WNK1, a kinase mutated in inherited hypertension with hyperkalemia, localizes to diverse Cl--transporting epithelia. Proc Natl Acad Sci U S A 100: 663–668, 2003[Abstract/Free Full Text]
Xu Q, Modrek B, Lee C: Genome-wide detection of tissue-specific alternative splicing in the human transcriptome. Nucleic Acids Res 30: 3754–3766, 2002[Abstract/Free Full Text]
Xu BE, Min X, Stippec S, Lee BH, Goldsmith EJ, Cobb MH: Regulation of WNK1 by an autoinhibitory domain and autophosphorylation. J Biol Chem 277: 48456–48462, 2002[Abstract/Free Full Text]
Pagani F, Buratti E, Stuani C, Bendix R, Dork T, Baralle FE: A new type of mutation causes a splicing defect in ATM. Nat Genet 30: 426–429, 2002[CrossRef][Medline]
Received for publication May 29, 2003.
Accepted for publication July 5, 2003.
This article has been cited by other articles:
C. Richardson and D. R. Alessi The regulation of salt transport and blood pressure by the WNK-SPAK/OSR1 signalling pathway
J. Cell Sci.,
October 15, 2008;
121(20):
3293 - 3304.
[Abstract][Full Text][PDF]
P. San-Cristobal, J. Ponce-Coria, N. Vazquez, N. A. Bobadilla, and G. Gamba WNK3 and WNK4 amino-terminal domain defines their effect on the renal Na+-Cl- cotransporter
Am J Physiol Renal Physiol,
October 1, 2008;
295(4):
F1199 - F1206.
[Abstract][Full Text][PDF]
G. Estilo, W. Liu, N. Pastor-Soler, P. Mitchell, M. D. Carattino, T. R. Kleyman, and L. M. Satlin Effect of aldosterone on BK channel expression in mammalian cortical collecting duct
Am J Physiol Renal Physiol,
September 1, 2008;
295(3):
F780 - F788.
[Abstract][Full Text][PDF]
J. A. McCormick, C.-L. Yang, and D. H. Ellison WNK Kinases and Renal Sodium Transport in Health and Disease: An Integrated View
Hypertension,
March 1, 2008;
51(3):
588 - 596.
[Full Text][PDF]
J.-B. Peng and D. G. Warnock WNK4-mediated regulation of renal ion transport proteins
Am J Physiol Renal Physiol,
October 1, 2007;
293(4):
F961 - F973.
[Abstract][Full Text][PDF]
F. Verrey WNK4, as thiazides, shuts off NaCl reabsorption to stimulate Na/K exchange
Nephrol. Dial. Transplant.,
May 1, 2007;
22(5):
1305 - 1308.
[Full Text][PDF]
M. O'Reilly, E. Marshall, T. MacGillivray, M. Mittal, W. Xue, C. J. Kenyon, and R. W. Brown Dietary Electrolyte-Driven Responses in the Renal WNK Kinase Pathway In Vivo
J. Am. Soc. Nephrol.,
September 1, 2006;
17(9):
2402 - 2413.
[Abstract][Full Text][PDF]
A. N. Anselmo, S. Earnest, W. Chen, Y.-C. Juang, S. C. Kim, Y. Zhao, and M. H. Cobb WNK1 and OSR1 regulate the Na+, K+, 2Cl- cotransporter in HeLa cells
PNAS,
July 18, 2006;
103(29):
10883 - 10888.
[Abstract][Full Text][PDF]
C. Delaloy, J. Hadchouel, M. Imbert-Teboul, M. Clemessy, A.-M. Houot, and X. Jeunemaitre Cardiovascular Expression of the Mouse WNK1 Gene during Development and Adulthood Revealed by a BAC Reporter Assay
Am. J. Pathol.,
July 1, 2006;
169(1):
105 - 118.
[Abstract][Full Text][PDF]
G. Cope, M. Murthy, A. P. Golbang, A. Hamad, C.-H. Liu, A. W. Cuthbert, and K. M. O'Shaughnessy WNK1 Affects Surface Expression of the ROMK Potassium Channel Independent of WNK4
J. Am. Soc. Nephrol.,
July 1, 2006;
17(7):
1867 - 1874.
[Abstract][Full Text][PDF]
Y. Fu, A. Subramanya, D. Rozansky, and D. M. Cohen WNK kinases influence TRPV4 channel function and localization
Am J Physiol Renal Physiol,
June 1, 2006;
290(6):
F1305 - F1314.
[Abstract][Full Text][PDF]
J. B. Wade, L. Fang, J. Liu, D. Li, C.-L. Yang, A. R. Subramanya, D. Maouyo, A. Mason, D. H. Ellison, and P. A. Welling WNK1 kinase isoform switch regulates renal potassium excretion
PNAS,
May 30, 2006;
103(22):
8558 - 8563.
[Abstract][Full Text][PDF]
A. S. L. Yu WNK signaling in the distal tubule: an inhibitory cascade regulating salt transport
Am J Physiol Renal Physiol,
March 1, 2006;
290(3):
F617 - F618.
[Full Text][PDF]
A. R. Subramanya, C.-L. Yang, X. Zhu, and D. H. Ellison Dominant-negative regulation of WNK1 by its kidney-specific kinase-defective isoform
Am J Physiol Renal Physiol,
March 1, 2006;
290(3):
F619 - F624.
[Abstract][Full Text][PDF]
A. Lazrak, Z. Liu, and C.-L. Huang Antagonistic regulation of ROMK by long and kidney-specific WNK1 isoforms
PNAS,
January 31, 2006;
103(5):
1615 - 1620.
[Abstract][Full Text][PDF]
J. Hadchouel, C. Delaloy, S. Faure, J.-M. Achard, and X. Jeunemaitre Familial Hyperkalemic Hypertension
J. Am. Soc. Nephrol.,
January 1, 2006;
17(1):
208 - 217.
[Full Text][PDF]
H. Zhang and J. A. Staessen Association of Blood Pressure With Genetic Variation in WNK Kinases in a White European Population
Circulation,
November 29, 2005;
112(22):
3371 - 3372.
[Full Text][PDF]
B.-e Xu, S. Stippec, P.-Y. Chu, A. Lazrak, X.-J. Li, B.-H. Lee, J. M. English, B. Ortega, C.-L. Huang, and M. H. Cobb WNK1 activates SGK1 to regulate the epithelial sodium channel
PNAS,
July 19, 2005;
102(29):
10315 - 10320.
[Abstract][Full Text][PDF]
G. Gamba Role of WNK kinases in regulating tubular salt and potassium transport and in the development of hypertension
Am J Physiol Renal Physiol,
February 1, 2005;
288(2):
F245 - F252.
[Abstract][Full Text][PDF]
A. Naray-Fejes-Toth, P. M. Snyder, and G. Fejes-Toth The kidney-specific WNK1 isoform is induced by aldosterone and stimulates epithelial sodium channel-mediated Na+ transport
PNAS,
December 14, 2004;
101(50):
17434 - 17439.
[Abstract][Full Text][PDF]
P. Meneton, J. Loffing, and D. G. Warnock Sodium and potassium handling by the aldosterone-sensitive distal nephron: the pivotal role of the distal and connecting tubule
Am J Physiol Renal Physiol,
October 1, 2004;
287(4):
F593 - F601.
[Abstract][Full Text][PDF]
Top
Abstract
Introduction
. 
