 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*Biomedicum, Molecular Medicine, University of Helsinki and Helsinki University Central Hospital, Helsinki, Finland; Haartman Institute, Department of Pathology, University of Helsinki, Helsinki, Finland; GSF Center for Environment and Health, Institute of Mammalian Genetics, Neuherberg, Germany; Max-Planck Institute for Molecular Genetics, Berlin, Germany; and ¶ Institute of Clinical Pathology, Division of Ultrastructural Pathology and Cell Biology, University of Vienna, Vienna, Austria.
Correspondence to Dr. Harry Holthöfer, Biomedicum, Molecular Medicine, University of Helsinki, PB 63, FIN-00014 Helsinki, Finland. Phone: +358-9-191-25500; Fax: +358-9-191 25501; E-mail: Harry.Holthofer{at}Helsinki.Fi
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-, appeared unchanged, whereas the major anionic apical membrane protein of podocytes, podocalyxin, somewhat punctate as compared with the wild-type (wt) and nephrinwt/trap stainings. Electron microscopy revealed that >90% of the podocyte foot processes were fused. The remaining interpodocyte junctions lacked slit diaphragms and, instead, showed tight adhering areas. In the heterozygote glomeruli, approximately one third of the foot processes were fused and real-time RT-PCR showed >60% decrease of nephrin-specific transcripts. These results show an effective nephrin gene elimination, resulting in a phenotype that resembles human congenital nephrotic syndrome. Although the nephrintrap/trap mice can be used to study the pathophysiology of the disease, the heterozygous mice may provide a useful model to study the gene dose effect of this crucial protein of the glomerular filtration barrier. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The identification of NPHS1 as the disease-causing gene in congenital nephrotic syndrome of the Finnish type (CNF) was a milestone in establishing the molecular composition of the interpodocyte slit diaphragm (2). Nephrin, the protein encoded by NPHS1, has been suggested to form the slit diaphragm by either homo- or heterophilic interactions creating pores that act as the ultimate sieve of the glomerular filter (2–4).
Subsequently, CD2-associated protein (CD2AP), originally found to enhance proper CD2-positioning required for antigen presentation (5), has been shown to bind nephrin and cause nephrotic syndrome in null mutant mice (6). A human homologue of CD2AP, Cas ligand with multiple Src-homology domains, has been suggested to regulate cytoskeletal rearrangements (7). Thus, CD2AP is considered as a strong candidate for linking nephrin to the cytoskeleton.
Recently, cloning of NPHS2, disrupted in autosomal recessive steroid-resistant nephrotic syndrome (8), and ACTN4, mutated in focal segmental glomerulosclerosis (9), were reported. NPHS2 encodes for the membrane-associated protein, podocin, which is the second interaction partner identified for nephrin and capable of modulating its signaling activity (10). The cytosolic protein product of ACTN4, -actinin-4, is an actin-filament crosslinking protein.
Despite knowing the important role of nephrin in the glomerular filtration barrier (11–14), a detailed understanding of its functions is still missing. Our results have shown alternative splicing of nephrin mRNA (11,12,15) and changes of nephrin mRNA levels during experimental renal diseases closely paralleled by loss of nephrin protein into urine (15). In addition, our recent experiments have revealed association of nephrin with lipid rafts of the slit diaphragm in which phosphorylation of nephrin can be induced (16). Together these results suggest a role for nephrin as a part of the molecular machinery that regulates and maintains the filtration barrier.
Several laboratories worldwide (17–21) currently employ gene-trapping method to execute a high-throughput screening for gene function. This method is based on random insertional mutagenesis caused by a vector containing a promoter- and/or ATG-less reporter/selector cassette preceded by a splice acceptor sequence. The gene-trap vector serves as a sequence-tag for the identification of the mutated locus and provides a reporter/selection marker for monitoring endogenous gene activity. Proper integration and splicing generates a fusion protein with the trapped locus and results in an effective gene disruption (reviewed in reference 22).
In this study, we describe the generation of mice with a gene-trap mutation in the Nphs1 gene for renal research. Our results both confirm and extend the data from traditional nephrin knockout mouse reported by Putaala et al. (23). This is the first study depicting the availability and changes in the expression of podocyte proteins in nephrin TRAP mice, including podocalyxin and CD2AP. In addition, we show the typical fusion of podocyte foot processes in nephrintrap/trap but partly also in nephrinwt/trap glomeruli, suggesting a gene dose effect. In support of this, the nephrin-specific mRNA level was reduced by more than 60% in heterozygotes.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
geo (19), and selected in 200 µg/ml G418. Resistant clones were isolated, and the site of integration was determined by 5'RACE (25). Chimeric mice were generated by blastocyst injection of the trapped nephrin clone WO27B02 (19). Male chimeras were bred on a C57BL/6 genetic background. Genotyping of the F1-generation was done by Southern blotting using a lacZ probe. In total, 147 animals derived from two heterozygous F1-matings and five heterozygous F2-matings as well as 28 embryos at embryonic day 12 (E12) and E18 from one heterozygous F1-mating and two F2-matings were thus genotyped by PCR as described below. All experiments were conducted within the guidelines of European convention and were approved by the local animal research ethics committee.
DNA Extraction and Genotyping by PCR
Quantum Prep AquaPure Genomic DNA Isolation Kit (Bio-Rad, Hercules, CA) was used for extraction of genomic DNA from mouse tail samples. Orientation and exact integration site of the gene-trap vector within the nephrin gene was determined by PCR using two primer pairs. The first primer pair, 5'acctggagctaccctgcata3' (forward) and 5' gaagaaggcacatggctga3' (reverse), amplifies a 2.5-kb region between nephrin exon 7 and LacZ in the PT1geo (Figure 1). The second primer pair, 5'ccgcttgtcctctttgttagg3' (forward) and 5'ggacttggtaaggcagcaaa3' (reverse), amplifies a 471-bp region between the lacZ and exon 9. For genotyping, the second primer pair was used to recognize the trapped allele and the third primer pair, the forward primer of the primer pair one and the reverse primer of the primer pair two amplifying a 524-bp product, was used to recognize the wt allele. Templates were subjected to 36 rounds of PCR (94°C for 30 s; 56°C for 30 s; 72°C for 1 min), and the amplification products were sequenced with an ABI 373 sequencer using ABI Prism Dye Terminator kit (Perkin-Elmer Applied Biosystems Division, Foster City, CA) at a local sequencing unit. Nucleotide homology comparisons of the sequenced amplification products described above were done via internet in GenBank database (26) using the BLAST search algorithm at the National Center for Biotechnology Institute (27).
|
Electron Microscopy of TRAP Mouse Kidneys
The method employed for transmission electron microscopy was essentially as described in reference (28 without the immunostaining. Kidneys from 1-wk-old mice were fixed with 3.5% paraformaldehyde PFA, 0.05% glutaraldehyde in phosphate-buffered saline (PBS) at 4°C followed by embedding in Lowicryl K4M (Chemische Werke LOWI, Waldkraiburg, Germany) (29). Ultrathin sections were counterstained with lead citrate.
Immunohistochemistry of TRAP Mouse Kidneys
The dissected kidneys from newborn mice, 3 to 7 of each genotype, were fixed in 3.5% PFA and embedded in paraffin. Two to four micrometer sections were deparaffinized, the antigen was unmasked with a microwave treatment, and the sections were stained with the HISTOMOUSE-SP Kit according to manufacturer’s instructions (Zymed Laboratories Inc., South San Francisco, CA). Affinity-purified rabbit polyclonal antibodies (pAb) recognizing the intracellular domain of nephrin (11), isoforms - and + of ZO-1 (Zymed Laboratories Inc.), and protein-A–purified rabbit pAb against CD2AP (30) and podocalyxin (31) were used as primary antibodies. The sections were analyzed by an Olympus BX50 microscope (Olympus Optical Co., Ltd., Tokyo, Japan) equipped with a Hamamatsu cooled digital CCD camera C4742–95 (Hamamatsu Inc.). Openlab 2.2.3 software (Improvision, Coventry, UK) was used for image documentation.
Western Blot Analyses
Mouse kidneys of E18 were homogenized in RIPA-buffer (150mM NaCl, 1% NP40, 0.5% deoxycholic acid, 0.1% sodium dodecyl sulfate [SDS], 50 mM Trizma base [pH 8], 0.02% NaN3) and centrifuged (5 min at 1500 x g), and the protein concentration of the supernatant was measured with BCA Protein Assay Kit (Pierce, Rockford, IL). Samples of 20 µg were boiled for 5 min at 100°C in reducing 1 x LSB-buffer (4 x LSB: 125 mM Tris-HCl [pH 6.8] 20% glycerol, 0.04% SDS, 10% 2-mercaptoethanol, 0.001% bromophenol blue) and run on reducing 8% polyacrylamide gels. The proteins were transferred on Hybond-C extra nitrocellulose membranes (Amersham Life Science, UK), which were blocked with 3% bovine serum albumin (BSA), 0.05% Tween-20 in PBS at 4°C o/n, and incubated 2 h at room temperature either with protein-A–purified rabbit intracellular nephrin pAb (1:400) or with preimmune serum (1:400). The membranes were washed with 0.2% Triton X-100 in PBS for 30 min at room temperature before and after incubation with affinity-purified peroxidase-conjugated goat anti-rabbit IgG in 1% BSA in PBS (1:45000) 1 h at room temperature (Jackson Immuno Research Laboratories, Inc. West Grove, PA). The Supersignal West Pico Chemiluminescent Substrate (Pierce) was used to detect the bound antibodies.
Quantification and RT-PCR of Nephrin-Specific mRNA of TRAP Mouse Kidneys
Total RNA was extracted from the adult kidneys with Trizol reagent (Life Technologies BRL, Paisley, UK) according to manufacturer’s instructions. RNA was treated with RQ1 DNAse I (Promega, Madison, WI), purified with phenol-chlorophorm (1:1) extraction and precipitated with ethanol. cDNA was prepared from RNA with the M-MLV reverse transcriptase (Promega) using oligo dT15 primers (Roche Diagnostics GmbH, Mannheim, Germany). The amount of nephrin-specific mRNA was determined with a real-time quantitative PCR method (32) by ABI PRISM 7700 Sequence Detector System (Perkin-Elmer Applied Biosystems Division). Universal Mastermix reaction mixture (Perkin Elmer Applied Biosystems Division), primers specific for nephrin exons 19 to 20, 5'atctccaagaccccaggtacaca3' (forward), 5'ttggtgtggtcagagccaag3' (reverse), and FAM (6-carboxy-fluorescein) labeled fluorogenic probe 5'ccctcttcaaatgcacggccacca3' were used. All samples were analyzed twice as triplicates as described (33). Briefly, the reactions (2 min at 50°C and 10 min at 95°C, followed by 40 15-s cycles at 95°C and 1 min at 60°C) were performed in the total reaction volume of 25 µl that included 900 nM of both primers and 225 nM probe. The expression level of nephrin mRNA was normalized by the endogenous level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The amplification signals were analyzed with Perkin-Elmer ABI Prism 7700 Sequence Detection software. The difference between nephrin expression in wt and nephrin wt/trap mice was examined for statistical significance—P < 0.05–by two-tailed Mann-Whitney test using Prism (Graphpad, San Diego, CA) analysis program. The following primers were used to amplify the mRNAs of E18 kidneys from all genotypes with RT-PCR: nephrin exons 19 to 20 (above); 7 to 9 (above); 22 to 28, 5'cggtacaggatctggctgtt 3' (forward), 5'ctctctccacctcgtcataca 3' (reverse); and -actin, 5'aaccgcgagaagatgacccagatcatgttt 3' (forward), 5'agcagccgtggccatctcttgctcgaagtc 3' (reverse).
Whole-Mount Immunofluorescence Staining of Embryonic Kidneys
The kidneys of 2 wt, 6 nephrinwt/trap, and 4 nephrintrap/trap mice were dissected on E12 and transferred on Nuclepore filters (Nuclepore Corp., Pleasanton, CA) with an average pore-size of 1 µm. The tissues were cultivated in a Trowell-type culture in modified Eagle medium supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, and antibiotics with 5% CO2 at 37°C for 6 d. The kidneys were fixed for 5 min in ice-cold methanol, washed with PBS, and incubated in primary monoclonal antibody (TROMA 1) recognizing cytokeratin 8 (34) at 4°C o/n. After PBS wash, the samples were treated with FITC-conjugated secondary antibody goat anti-rat IgG (Jackson Immuno Research Laboratories, Inc.) at 4°C o/n. The antibodies were diluted in PBS, 0.5% saponin, and 5% FCS. After washing with PBS, the kidneys were mounted with 50% glycerol in PBS supplemented with 100 mg/ml DABCO (1,4-diazabicyclo-(2.2.2)-octane) (Sigma, St. Louis, MO). Fluorescence microscopy was performed with Olympus microscope (Olympus Optical Co., Ltd.). The extent of ureter branching was quantified by counting the dichotomal divisions.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Among the genotyped offspring (n = 147) of six nephrinwt/trap breeding pairs, there were 45 wt and 88 heterozygous mice (Table 1). Only 14 mice were homozygous for the trapped nephrin gene. Thirteen of them died or were killed instantly after birth. One homozygote survived for 7 d, but it was significantly smaller than the other pups in the litter and showed severe proteinuria of >20 mg/ml. The urine of the other genotypes was negative or contained only a trace of protein. The total number of offspring was significantly higher than 147 because at least 9 pups disappeared soon after birth. To check for embryonic lethality, we genotyped 28 embryos and found 6 wt, 11 heterozygous, and 11 homozygous mice.
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We here describe the generation and phenotypic characterization of a nephrin mutant mouse line generated by an alternative rapid gene disruption method, gene-trapping. In the gene-trap approach, a vector containing promoterless selectable marker gene preceded by a strong splice acceptor sequence is used (19,22,24). The random integration into an intron, promoter, or in-frame into an exon of an actively transcribed gene usually results in a fusion transcript that will be expressed and can be identified. The gene-trap vector was here integrated in an inverted orientation into the 5' end of exon 8 of the nephrin gene, resulting in a null mutation. Interestingly, despite the vector orientation, the trapped ES cells were successfully selected with the help of the selection marker gene, but lacZ staining of embryos did not succeed. This phenomenon is currently under further study.
Nephrintrap/trap animals show early postnatal lethality and morphology typical for proteinuric diseases. The kidney tissue is perforated by tubular dilations, and the nephrinless homozygote glomeruli show early deposition of matrix, fusion of podocyte foot processes, and lack of interpodocyte filtration slits. These structural similarities with the human disease of CNF (36) confirm that the Nphs1 gene is disrupted. The two major CNF types, Finmajor and Finminor, with point mutations in exons 2 and 26, respectively, similarly result in lack of nephrin, uncontrollable proteinuria, and need for renal transplantation (36,37). Whether the final cause of postnatal lethality of nephrintrap/trap mice is proteinuria remains speculative. One nephrintrap/trap mouse was found massively proteinuric but alive at the age of 1 wk. In this case, the litter was small, allowing easy access to weaning, thus making it more feasible to compensate for urinary protein loss. In support to this, the homozygotes in larger litters always died soon after birth. However, an alternative cause of early lethality cannot be excluded as yet; nephrin missing in the pancreatic insulin producing beta cells (38) could result in severe dysregulation of blood glucose homeostasis. This alternative is currently being analyzed in detail.
A marked decrease in the nephrin-specific mRNA level has previously been reported in the human minimal change nephrosis and in the puromycin aminonucleocide nephrosis of the rat mimicking the human disease (13,39). Given the drastic consequences of complete lack of nephrin, it will be interesting to define the treshold of nephrin expression sufficient for maintaining healthy glomerular filtration. In the nephrinwt/trap mice, the nephrin mRNA level was reduced by >60%. At present, there is no data available about the mRNA level of nephrin in human carriers of the NPHS1 mutations. Similarly to nephrinwt/trap mice, adult carriers are fertile and do not have notable proteinuria (39). Nevertheless, recent initial studies suggest that fetal CNF carriers temporarily suffer from proteinuria and could show foot process fusion in utero (40). In agreement with this, partially fused foot processes were found from young nephrinwt/trap glomeruli, suggesting a true gene dose effect of nephrin.
During the past years, a large number of studies have implied a dynamic cytoskeleton-driven regulation of podocyte morphologic changes both in vivo and in vitro (41,42). The first reported interaction partner of nephrin, CD2AP (6), apparently participates in the regulation of cytoskeletal rearrangements (5,7). Incidentally, both the Cd2ap knockout (6) and nephrintrap/trap mice develop a nephrotic syndrome. In the Cd2ap knockout mice, nephrin staining is unaffected at birth and changes only after several weeks (43). We did not observe appreciable changes in CD2AP staining of the newborn nephrintrap/trap mouse glomeruli. The expression pattern of the well-studied peripheral membrane protein ZO-1- located at the slit diaphragm area (44) appeared unchanged as well. Similar results have been reported previously in various proteinuric states by Bains et al. (45).
Podocalyxin is a podocyte apical membrane protein that functions as a negatively charged antiadhesin that maintains the interpodocyte filtration route open (46,47). The connection between podocalyxin and cytoskeleton was recently shown to be mediated by Na+/H+-exchanger regulatory factor 2 and ezrin (48,49). Disruption of this protein complex is found in rat models of proteinuria showing effacement of podocyte foot processes and alteration of slit diaphragm structure (48). Interestingly, the podocalyxin staining in nephrintrap/trap glomeruli appeared somewhat punctate. A similar phenomenon has been shown for nephrin in patients with nephrotic syndrome as well as in cultured podocytes stimulated with membrane attack complex, tumor necrosis factor– or puromycin (50). In the cultured podocytes, this redistribution or loss of cell surface staining was prevented by cytochalasin B, suggesting cytoskeletal involvement in the dislocation of nephrin. Therefore, the dotted staining pattern of podocalyxin in nephrintrap/trap mice could reflect extensive cytoskeletal rearrangements in the flattened podocytes.
All these data suggest that many of the proteins that are crucial for the structure and function of the podocytes rely on complex interactions to the actin cytoskeleton. Nephrin, the key component of the slit diaphragm, also appears to be involved in these interactions. With the aid of the nephrin TRAP mice, the precise molecular complexes necessary for the maintenance of an intact glomerular filtration barrier can now be effectively studied.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. E. Quaggin and J. A. Kreidberg Development of the renal glomerulus: good neighbors and good fences Development, February 15, 2008; 135(4): 609 - 620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Holthofer Molecular architecture of the glomerular slit diaphragm: lessons learnt for a better understanding of disease pathogenesis Nephrol. Dial. Transplant., August 1, 2007; 22(8): 2124 - 2128. [Full Text] [PDF]
|
|
|
|
|
|
P. Aaltonen, J. Rinta-Valkama, A. Patari, P. Tossavainen, T. Palmen, P. Kulmala, M. Knip, and H. Holthofer Circulating antibodies to nephrin in patients with type 1 diabetes Nephrol. Dial. Transplant., January 1, 2007; 22(1): 146 - 153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zuo, T. Matsusaka, J. Zhong, J. Ma, L.-j. Ma, Z. Hanna, P. Jolicoeur, A. B. Fogo, and I. Ichikawa HIV-1 Genes vpr and nef Synergistically Damage Podocytes, Leading to Glomerulosclerosis J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2832 - 2843. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Kalluri Proteinuria with and without Renal Glomerular Podocyte Effacement J. Am. Soc. Nephrol., September 1, 2006; 17(9): 2383 - 2389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Benigni, C. Zoja, S. Tomasoni, M. Campana, D. Corna, C. Zanchi, E. Gagliardini, E. Garofano, D. Rottoli, T. Ito, et al. Transcriptional Regulation of Nephrin Gene by Peroxisome Proliferator-Activated Receptor-{gamma} Agonist: Molecular Mechanism of the Antiproteinuric Effect of Pioglitazone J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1624 - 1632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Juhila, R. Roozendaal, M. Lassila, S. J. Verbeek, and H. Holthofer Podocyte Cell-Specific Expression of Doxycycline Inducible Cre Recombinase in Mice J. Am. Soc. Nephrol., March 1, 2006; 17(3): 648 - 654. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Gao, S. Maiti, G. Sun, N. G. Ordonez, M. Udtha, J. M. Deng, R. R. Behringer, and V. Huff The Wt1+/R394W Mouse Displays Glomerulosclerosis and Early-Onset Renal Failure Characteristic of Human Denys-Drash Syndrome Mol. Cell. Biol., November 15, 2004; 24(22): 9899 - 9910. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Lehtonen, E. Lehtonen, K. Kudlicka, H. Holthofer, and M. G. Farquhar Nephrin Forms a Complex with Adherens Junction Proteins and CASK in Podocytes and in Madin-Darby Canine Kidney Cells Expressing Nephrin Am. J. Pathol., September 1, 2004; 165(3): 923 - 936. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kojima, A. Davidovits, H. Poczewski, B. Langer, S. Uchida, K. Nagy-Bojarski, A. Hovorka, R. Sedivy, and D. Kerjaschki Podocyte Flattening and Disorder of Glomerular Basement Membrane Are Associated with Splitting of Dystroglycan-Matrix Interaction J. Am. Soc. Nephrol., August 1, 2004; 15(8): 2079 - 2089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Roselli, L. Heidet, M. Sich, A. Henger, M. Kretzler, M.-C. Gubler, and C. Antignac Early Glomerular Filtration Defect and Severe Renal Disease in Podocin-Deficient Mice Mol. Cell. Biol., January 15, 2004; 24(2): 550 - 560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Hansen, T. Floss, P. Van Sloun, E.-M. Fuchtbauer, F. Vauti, H.-H. Arnold, F. Schnutgen, W. Wurst, H. von Melchner, and P. Ruiz A large-scale, gene-driven mutagenesis approach for the functional analysis of the mouse genome PNAS, August 19, 2003; 100(17): 9918 - 9922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Ciani, A. Patel, N. D. Allen, and C. ffrench-Constant Mice Lacking the Giant Protocadherin mFAT1 Exhibit Renal Slit Junction Abnormalities and a Partially Penetrant Cyclopia and Anophthalmia Phenotype Mol. Cell. Biol., May 15, 2003; 23(10): 3575 - 3582. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Sugimoto, Y. Hamano, D. Charytan, D. Cosgrove, M. Kieran, A. Sudhakar, and R. Kalluri Neutralization of Circulating Vascular Endothelial Growth Factor (VEGF) by Anti-VEGF Antibodies and Soluble VEGF Receptor 1 (sFlt-1) Induces Proteinuria J. Biol. Chem., April 4, 2003; 278(15): 12605 - 12608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Kreidberg Podocyte Differentiation and Glomerulogenesis J. Am. Soc. Nephrol., March 1, 2003; 14(3): 806 - 814. [Full Text] [PDF]
|
|
|
|
|
|
P. Mundel and S. J. Shankland Podocyte Biology and Response to Injury J. Am. Soc. Nephrol., December 1, 2002; 13(12): 3005 - 3015. [Full Text] [PDF]
|
|
|
|
|
|
M. R. Pollak Inherited Podocytopathies: FSGS and Nephrotic Syndrome from a Genetic Viewpoint J. Am. Soc. Nephrol., December 1, 2002; 13(12): 3016 - 3023. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||
