Transcription Factor Ets-1 Regulates Gelatinase A Gene Expression in Mesangial Cells
Julia Reisdorff*,
Abdelaziz En-Nia*,
Ioannis Stefanidis*,
Jürgen Floege*,
David H. Lovett and
Peter R. Mertens*
*Department of Nephrology and Immunology, Rheinisch-Westfälische Technische Hochschule Aachen, Germany; The Department of Medicine, San Francisco VAMC/University of California, San Francisco, California.
Correspondence to Dr. Peter R. Mertens, Department of Nephrology and Immunology, RWTH Aachen, Pauwelsstrae 30, 52057 Aachen, Germany. Phone: +49-241-8089532; Fax: +49-241-8082446; E-mail: Pmertens{at}ukaachen.de
ABSTRACT. Ets transcription factors are involved in cell growthand angiogenesis. Ets-1 targets include members of the matrixmetalloproteinase superfamily. In inflammatory glomerular diseases,the patterns and regulation of Ets expression have not beenfully characterized. In the present study, nuclear binding activitiesto the consensus Ets-1/PEA3 motif were detected in mesangialcells (MC), and the Ets-1 protein was positively identifiedby Western blotting, reverse transcription PCR (RT-PCR), andDNA-binding studies. The 5' flanking regions of the human andrat gelatinase A genes contain clusters of potential Ets-1 bindingmotifs, one of which is evolutionarily conserved. Using a seriesof 5' deletion reporter constructs of the rat gelatinase A geneand an Ets-1 expression plasmid, a concentration-dependent threefoldtrans-activation of gene expression mapped to the conservedEts-1 binding motif at -1004/-1053 bps, designated responsiveelement-2 (RE-2). The RE-2 was operative within the contextof the homologous gelatinase A promoter but not with a heterologoussimian virus 40 promoter. Specific Ets-1 binding to this sequencewas demonstrated by DNA-binding studies. Transient expressionof an Ets-1 expression plasmid increased gelatinase A proteinexpression. Our findings identify an additional matrix metalloproteinasefamily member, gelatinase A, as an Ets-1 responsive gene inMC that may play a role in the high level expression of thisenzyme in inflammatory glomerular diseases.
Mesangial cell (MC) proliferation, increased matrix turnover,and accumulation of interstitial collagens are common findingsin most forms of progressive glomerular diseases (1). Thesechanges generally continue even after removal of the initialcausative event, progressively resulting in destruction of theglomerular architecture with the final outcome of glomerularscarring (1). Recent findings have elucidated a pivotal rolefor the "activated MC" phenotype (2). In contrast to the quiescentMC found within normal glomeruli, activated MC predominantlysecrete interstitial type I and III collagens. Concurrently,high-level expression of matrix metalloproteinase-2 (MMP-2,72-kD type IV collagenase, gelatinase A) is found (3,4). GelatinaseA belongs to the matrix metalloproteinase gene superfamily,all of which are secreted as latent proenzymes with subsequentactivation by proteolysis in the extracellular space. The enzymaticactivity of the MMP is dependent on the presence of zinc anddivalent cations (5), and these enzymes exhibit broad substratespecificity (6). In addition to the role of gelatinase A inglomerular extracellular matrix turnover, the enzyme has a directinfluence on the MC phenotype. Turck et al. (7) have shown thattargeted deletion of gelatinase A in MC results in an exit fromthe cell cycle and development of a phenotype resembling quiescentMC in vivo. Addition of exogenous gelatinase A, but not gelatinaseB, promoted MC proliferation with reacquisition of the proscleroticphenotype (7). Concordant gelatinase A expression and MC proliferationhas been detected in vivo and is a common finding in mesangioproliferativediseases (8). Altogether, these findings lend support for theimportant role of gelatinase A in the progression of glomerularsclerosis.
To gain insight into the regulatory events orchestrating gelatinaseA gene expression, extensive studies have been performed onthe human and rat gelatinase A regulatory sequences. As a result,an evolutionarily conserved enhancer element, designated responseelement-1 (RE-1; -1282/-1322 bps), and a silencer element wereisolated (9–11). The RE-1 confers approximately 80% ofthe transcriptional activity controlling constitutive gene expression.In addition to the proximal promoter and the RE-1, a third regionat -1004/-1053 bps (rat) exhibits a high degree of sequencesimilarity with the human gelatinase A gene (at -1245/-1293bps). Within this sequence, a consensus Ets-1 binding site wasidentified, whereas other transcription factor binding motifswere absent. Our results demonstrate a MC-specific increaseof gelatinase A gene transcription through transcription factorEts-1 binding to this element.
Cells and Culture Conditions
Rat MC were established and characterized as described previously(7,12) and were grown in RPMI 1640 medium supplemented with10% fetal calf serum, 2 mM L-glutamine, 100 µg/ml streptomycin,and 100 U/ml penicillin at 37°C in humidified 5% CO2 inair. The immortalized human MC line was kindly provided by BernhardBanas (Ludwig-Maxmilians-University, Munich, Germany) and culturedas described previously (13). Human umbilical vascular endothelialcells (HUVEC) were isolated as described (14). The cells werecultured on gelatin-coated culture flasks in medium M199 withEarle salts supplemented with 20% fetal calf serum, 25 µg/mlendothelial growth supplement (Collaborative Research, Bedford,MA), and 25 µg/ml heparin.
Nuclear and Cytoplasmic Cell Extracts
Cells were grown to 80% confluency in tissue culture flasks,washed twice with ice-cold phosphate-buffered saline (PBS) withoutcalcium and magnesium, and scraped in 10 ml of cold PBS. Nuclearcell extracts were prepared as described previously (12). Nuclearprotein concentrations were determined by the Bio-Rad (Hercules,CA) protein assay using bovine serum albumin (BSA) as standard.Nuclear extracts were stored at -80°C until performanceof electrophoretic mobility shift analysis, Western blotting,or Southwestern blotting.
Electrophoretic Mobility Shift Analyses
Double-stranded probes were generated by heating complementarysynthetic oligonucleotides for 10 min at 95°C with subsequentcooling to room temperature over 6 h. The PEA3/Ets-1 probe harboringthe sequence 5'-GATCTCGAGCAGGAAGTTCGA-3' contains an Ets-1 consensusbinding site (15). The evolutionarily conserved sequence -1053TTTAGCTTTTTCCAGGAACAGCTCAGAAGTCACTTC TTCCAAGAAGCATFT-1004 ofthe rat gelatinase A regulatory sequence was denoted responseelement-2 (RE-2). In the RE-2mut oligonucleotide probe, a site-directedmutation (GG to TT transition) was performed within the Ets-1core-binding motif "AGGA." The remainder probes used for bindingassays consisted of 21-mers harboring the putative Ets-1 bindingsites depicted in Figure 3A. All probes were radiolabeled bymeans of T4-polynucleotide kinase using [-2P]ATP and were purifiedon 14% polyacrylamide gels and eluted, and 6 x 104 cpm of labeledprobe was included per binding reaction. Binding reactions wereperformed at 22°C for 30 min in binding buffer (20 mM HEPES[pH 7.9], 20% glycerol, 0.1 M NaCl, 0.2 mM EDTA) containing0.2 mM PMSF, 0.5 mM DTT, 300 µg/ml acetylated BSA, and2 µg of poly(dI-dC) in a total volume of 25 µl uponaddition of nuclear or cytoplasmic extracts (15 µg totalprotein/binding reaction if not otherwise indicated). Sampleswere electrophoresed on nondenaturing 4% polyacrylamide, 7.5%glycerol gels in a buffer containing 1 x Tris/borate/EDTA beforeautoradiography.
Figure 3. (A) Potential Ets-1 binding motifs within the human and rat gelatinase A regulatory sequences. The computer-based search program (MatInspector) was used to identify Ets binding motifs within the rat promoter sequence (accession no. gi940180) published hitherto (9), yielding 16 putative Ets-1 binding sites. Matrix positions and orientations are indicated for the sense (+) and antisense (-) strands in panel A; numbers given relate to data base annotations. Capital letters within the sequence highlight the core string. Sequences with matrix similarities higher than 0.85 were selected. Probability of random events (re) is calculated as 1.53. (B) Sequence similarities within the human and rat gelatinase A promoter. A direct sequence comparison of the human and rat gelatinase A promoter region revealed three distinct regions of homology, the proximal promoter, the response element-1 (10), and a region at -1245/-1293 bps (human) and -1004/-1053 bps (rat) relative to the respective translation start sites, depicted in panel B. Interspecies comparison of this 50 bp fragment, denoted response element-2 (RE-2), revealed an 84% overall sequence similarity, including a highly conserved Ets-1 binding motif. In DNA binding studies an oligonucleotide harboring a mutation within the "GGAA" core sequence was used.
Reverse Transcription PCR
Isolation of mRNA was performed with the Oligotex mRNA kit (Qiagen,Chatsworth, CA) according to the manufacturer’s instructions.Reverse transcription was achieved by addition of AMV reversetranscriptase (Promega, Madison, WI) in a reaction buffer containing4 µl (40 U/µl) of RNase inhibitor (Roche MolecularBiochemicals, Summerville, NJ), 0.5 µg of oligo d(T)1–18,0.5 nM dNTPs, and incubation for 2 h at 42°C and for 5 minat 95°C. Subsequently, cDNAs were precipitated and PCR wereperformed by addition of 2 U Taq polymerase (Life Technologies-BRL,Grand Island, NY) in reaction buffer (200 mM TrisHCl [pH 8.3],0.5 M KCl, 1.5 mM MgCl2), 0.25 pmol dNTPs, 25 pmol primers (specificEts-1 primers for full-length rat ets-1 transcripts were: 5'-ATGAAGGCGGCCGTCGATCT-3'and 5'-TTACTCATCAGCATCCGGCTTCA-3'). A high sequence homologyof these primers with the human ets-1 gene exists, whereas otherEts-1 members do not show sequence similarities. After heatingat 95°C for 2 min, a total of 40 cycles were performed with30 s at 95°C, 30 s at 53°C, and 30 s at 72°C. Thefinal reaction was kept at 72°C for 7 min, and the amplifiedfragments were subsequently electrophoresed on an 1.5% agarose/ethidiumbromide gel.
Southwestern Blot Analyses
Nuclear extracts from MC (7.5 µg/lane) were electrophoresedon a 12.5% sodium dodecyl sulfate (SDS)–polyacrylamidegel and transferred onto nitrocellulose membranes by electroblotting.Membranes were blocked in 25 mM HEPES [pH 8.0], 10% glycerol,50 mM NaCl, 1 mM EDTA, 2% BSA for 12 h at 4°C, washed for5 min in TNE-50 buffer (10 mM Tris/HCl [pH 7.5], 50 mM NaCl,1 mM EDTA, 1 mM DTT), and probed for 4 h at 22°C in TNE-50containing radiolabeled double-stranded oligonucleotide (105cpm/ml). The membranes were washed three times in TNE-50 bufferat 4°C for 1 min each, before autoradiography.
Western Blot Analyses
Nuclear extracts (7.5 µg/lane) from MC were electrophoresedon 12.5% SDS-polyacrylamide gel and transferred onto nitrocellulosemembranes. Membranes were blocked for 2 h at 22°C in TTBS(10 mM Tris [pH 8.0], 150 mM NaCl, 0.05% Tween-20) containing2% BSA before three washes with TTBS and incubation with primaryantibodies (at 1:2000 dilution) overnight at 4°C. As primaryantibodies polyclonal rabbit anti–Ets-1 antibody N276(Santa Cruz Biotechnology, Heidelburg, Germany) raised againsta peptide mapping with the amino terminal domain of Ets-1 (AA55–70) or polyclonal rabbit anti-ets-1 antibodies C20(AA 422–441) and C275 (both from Santa Cruz Biotechnology)raised against peptides mapping within the carboxy terminaldomain of Ets-1 were used. The C20 and C275 antibodies exhibita broad crossreactivity with other members of the Ets transcriptionfactor family, whereas the N-276 antibody is specific for Ets-1.As secondary antibody, donkey anti-rabbit HRP-linked F(ab')2fragment immunglobulin (1:5000; Amersham/Pharmacia Biotech,Piscataway, NJ) was used, and band detection was achieved usingECL detection reagent (Amersham/Pharmacia Biotech).
Transient Transfection Studies
Transient transfection of MC was performed with liposomal preparationTfx-50 (Promega) as described (16). Purified plasmid DNA wasdiluted in 1000 µl of RPMI 1640 medium, mixed with sterileTfx-50 preparation (4.5 µl/µg DNA), and incubatedat room temperature for 15 min. MC were grown to 60 to 70% confluencyin six-well culture plates and washed twice with PBS. To eachwell, 1 ml DNA/liposome mixture was added and incubated for2.5 h at 37°C with subsequent addition of complete 10% FCS/RPMImedium. Cell lysis, -galactosidase, and luciferase assays wereperformed after 48 h (10). Eukaryotic expression plasmids usedinclude the vector pEVRF harboring the full-length ets-1 sequence(pEVRF-ets-1) and pSG5 (Stratagene, La Jolla, CA) containingfull-length YB-1 (pSG5-YB-1) (12). A series of luciferase reporterconstructs harboring rat gelatinase A regulatory sequences ofup to 1686 bps relative to the translational start site subclonedinto pGL2-basic (Promega) were evaluated (9). In cotransfectionexperiments, 1 µg of luciferase reporter plasmid was combinedwith increasing amount of pEVRF-ets-1 plasmid ranging from 0.1µg to 4.0 µg DNA/well. The total DNA content wasequalized by inclusion of pEVRF plasmid. As control for transfectionefficiency, pSV40-Gal plasmid (1 µg/well; Promega) wasincluded.
Zymography
For semiquantitative gelatin zymography cell culture mediumwas exchanged with serum-free medium containing 0.2% bovinealbumin and conditioned for 48 h. Before conditioning, cellswere transiently transfected with plasmids pEVRF (1 µg/well),pEVRF-ets-1 (1 µg/well), pSG5-YB-1 (1 µg/well),and pSG5-YB-1/pEVRF-ets-1 combined (0.5 µg each/well)in 6-well plates, as described above. Ten microliter aliquotsof conditioned media were suspended in nonreducing sample buffer,electrophoresed on a 7.5% SDS-polyacrylamide gel containing2 mg/ml gelatin, washed in renaturating buffer (50 mM Tris/HCl[pH 8.0], 2.5% Triton X-100), and incubated overnight at 37°Cin 50 mM Tris/HCl [pH 8.0], 1 µM ZnSO4, 5 mM CaCl2. Gelswere methanol-fixed, stained with Coomassie Blue R-250 beforedestaining. Relative band intensities were assessed using Phoretixcomputer densitometry software (Biostep, Jahnsdorf, Germany).
Experimental Anti–Thy-1.1 Nephritis Model and Immunoperoxidase Staining
Anti–Thy-1.1 mesangial proliferative glomerulonephritiswas induced in male Wistar rats (Charles River, Sulzfeld, Germany)weighing 140 to 160 g at the start of the experiment by injectionof 1 mg/kg monoclonal anti–Thy-1.1 antibody (clone OX-7;European Collection of Animal Cell Cultures, Salisbury, UK).Animals were killed, and kidney specimens for immunohistologywere obtained before disease induction and on day 7 after diseaseinduction (n = 4). Four-micrometer sections of methyl Carnoyfixed biopsy tissue were processed by an indirect immunoperoxidasetechnique as described previously (17). Primary antibodies includedpolyclonal rabbit anti-human Ets-1 antibody (N-276, Santa CruzBiotechnology) and a murine monoclonal antibody (clone 1A4)directed against -smooth muscle actin. Negative controls consistedof substitution of the primary antibody with equivalent concentrationsof normal rabbit IgG. Double immunostaining for the identificationof Ets-1–expressing MC was performed as reported (18)by first staining the sections for Ets-1 with an anti–Ets-1antibody (N-276, Santa Cruz Biotechnology) using an indirectimmunoperoxidase procedure. Sections were then incubated withthe IgG1 monoclonal antibody 1A4 against -smooth muscle actin.
Materials
Cell culture materials, radioisotopes, and electrophoresis materialswere purchased from Life Technologies-BRL, Amersham-PharmaciaInternational, and Bio-Rad, respectively.
MC Expression of Ets Transcription Factor Family Members
Although previous studies have shown Ets family member expressionby endothelial cells (EC), epithelial cells, and fibroblasts,studies on MC have not been performed. Using complementary methodologicalapproaches, Ets-1 expression was analyzed in human and rat MC.Two polyclonal antibodies raised against different Ets proteinepitopes were used for Western blot analyses of rat and humanMC nuclear and cytosolic extracts. Anti–Ets-1 antibodyC275 recognizes a conserved epitope in the protein C-terminus,and anti–Ets-1 antibody N276 was raised against an epitopein the N-terminus and is specific for Ets-1. As shown in Figure 1A,four distinct bands of molecular sizes 15, 33, 54, 65, and97 kD were detected under reducing conditions with antibodyC275, whereas no band was present after omission of primaryantibody. In similar experiments using the anti–Ets-1antibody N276, which does not crossreact with other Ets transcriptionfactor family members, one predominant band of 54 kD was detected(Figure 1B). In addition, a weak band with molecular size of56 kD was seen, presumably representing phosphorylated Ets-1protein (19). To confirm that the detected bands correspondto Ets transcription factor family members, Southwestern blotanalyses were performed using a radiolabeled double-strandedoligonucleotide probe that harbors the Ets-1/PEA3 consensusbinding motif (19). Here a banding pattern similar to Westernblotting could be seen with molecular sizes of 15, 33, 54, and65 kD (Figure 1C). As the 97 kD band was not present in theSouthwestern blots, this band presumably represents either nonspecificantibody detection or an Ets-related protein without DNA bindingaffinity.
Figure 1. Mesangial cells (MC) express several Ets proteins including Ets-1. Nuclear (NE) and cytosolic extracts (CE) from rat MC were analyzed by Western blotting using two different anti–Ets-1 antibodies directed against epitopes within the protein C- (C275; panel A) and N-terminal regions (N276; panel B). With antibody C275, bands corresponding to 15, 33, 54, 65, and 97 kDa were detected in both subfractions (lanes 1 and 2 in panel A), whereas a control reaction performed in the absence of primary antibodies revealed no bands (lane 3 in panel A). With antibody N276, a major band of molecular size 54 kD and a faint band of 56 kD was present with nuclear and cytosolic extract (lanes 1 and 2 in panel B). Southwestern blotting was performed using a radiolabeled oligonucleotide encompassing the consensus Ets-1/PEA3–binding motif (C), yielding a similar band patterning as the one obtained with crossreactive antibody C275 with molecular sizes of 15, 33, 54, and 65 kDa, whereas the 97 kD band was absent. In the cytoplasmic fraction, similar binding activities were present, but with lower amounts of the 54 and 65 kD proteins.
To directly demonstrate the presence of ets-1 mRNA in MC, specificprimers designed for amplification of full-length human andrat ets-1 cDNA were used in RT-PCR (Figure 2A). A plasmid containingthe full-length ets-1 cDNA was included as positive control(lane 2). In this experiment, a single transcript size of approximately1300 bps was detected by RT-PCR with human and rat MC mRNA (lanes3 and 4). This size directly corresponded to the full-lengthets-1 transcript size in the control reaction (lane 2).
Figure 2. (A) Detection of ets-1 mRNA in human and rat mesangial cells. Ets-1 mRNA was detected by reverse transcription PCR (RT-PCR) analyses in human (lane 4 in panel A) and rat MC (lane 3 in panel A). Lane 2: pEVRF-ets-1 control. (B) Comparative analyses of Ets/PEA3 binding activities in endothelial cells (EC) and mesangial cells (MC). In electrophoretic mobility shift analyses, a labeled Ets-1/PEA3 consensus oligonucleotide harboring the double-stranded Ets-1 binding motif "GGAA" was used to assess binding of endogenous nuclear protein(s) prepared from human EC and rat MC. With inclusion of EC, nuclear proteins a major and minor complex was detected (indicated by "3>" and "2>" in lane 2), which were successfully competed by addition of homologous (s) but not heterologous (ns) competitor DNA in 100-fold molar excess (lanes 3 and 4). In contrast, one major complex with a lower mobility (indicated by "1>") and two minor complexes were detected with MC nuclear extract. Binding specificity was confirmed by inclusion of specific (s) and nonspecific (ns) competitor DNA (lanes 6 and 7).
In addition, DNA-binding studies were performed using an oligonucleotideharboring the Ets-1/PEA3 binding motif and nuclear proteinsobtained from rat MC and human vascular EC. As can be seen inFigure 2B, one major (indicated by 3>) and one minor (indicatedby 2>) nucleoprotein complex formed with addition of EC nuclearextract, whereas three distinct complexes were distinguishedwith MC nuclear extract. The mobility of the most prominentcomplex seen with MC extracts was slower than the one observedwith EC extract, whereas complexes "2>" and "3>" exhibitedsimilar mobilities with extracts from both cell types. Bindingspecificities were confirmed for all complexes by specific competitionwith inclusion of homologous DNA (in a 100-fold molar excess)and unchanged complex formation in the presence of heterologousDNA. These results confirm the expression of Ets including Ets-1proteins by MC and suggest the presence of different Ets familymembers or interacting proteins in MC as compared with EC.
The Gelatinase A Regulatory Sequence Contains Several Putative Ets-1 Binding Sites
Although Ets-1 regulates the expression of several MMP familymembers, an influence on gelatinase A expression is yet notreported. As a first step, a computerized search for potentialEts-1 binding sites within the human and rat gelatinase A regulatorysequences was performed using the MatInspector program version2.2 (Genomatix, Munich, Germany) (20). The application of suchsequence analysis algorithms does not permit an exact predictionof Ets-1 binding and trans-regulation, but it may hint at potentialregions of importance. Within the published rat regulatory sequenceup to -1686 bp, a total of 16 putative Ets-1 binding sites containingthe GGA core sequence were detected, the locations of whichare given in Figure 3A (+ and - denominate sense and antisensestrands). Sequences with matrix similarities higher than 0.85were selected. The expected number of sites due to random event(re) is 1.53. In a similar search performed with the human gelatinaseA regulatory sequence, a total of 12 potential Ets-1 bindingsites were detected (not shown). Among these, a region between-1245/-1293 exhibited high similarity between both species (correspondingto -1053/-1004 in the rat gene), which included a single Ets-1binding motif (depicted in Figure 3B).
Ets-1 Trans-Activates the Gelatinase A Gene Expression
To test for Ets-1–dependent regulation of the gelatinaseA gene a series of transient transfection experiments were performedusing luciferase reporter constructs. The construct pT4Luc1686contains the entire rat gelatinase A regulatory sequence upto -1686 bps relative to the translational start site and includesthe homologous promoter and the RE-1 enhancer element locatedat -1322/-1282 bps. For cotransfections, increasing concentrationsof the eukaryotic expression plasmid pEVRF–ets-1 (0.1to 4 µg/well) were included, and care was taken that thetotal DNA amount was kept equal in each reaction by inclusionof control plasmid pEVRF. As can be seen in Figure 4, cotransfectionof the pEVRF–ets-1 expression plasmid increased pT4Luc1686luciferase activity nearly fourfold. Control reactions performedwith the empty reporter construct pGL2basic demonstrated noeffect of pEVRF–ets-1.
Figure 4. Ets-1 trans-activates gelatinase A transcription. Reporter construct pT4-Luc 1686, harboring the 5' regulatory sequence up to -1686 bps of the rat gelatinase A gene was transiently transfected into rat MC along with increasing concentrations of an Ets-1 expression plasmid (pEVRF–ets-1; 0.1 to 4 µg). Control reactions were performed with the empty reporter construct pGL2basic. Ets-1 concentration-dependently trans-activated gene transcription up to 3.75-fold. Transcriptional activities are reported as fold-induction compared with the activity of pT4-Luc 1686 cotransfected with 4 µg of control plasmid pEVRF, arbitrarily set as 1. Relative luciferase activities were determined as mentioned above. All data represent means of three independent experiments with SD <15%.
It can be concluded from these results that in the context ofthe previously described rat gelatinase A regulatory sequenceEts-1 trans-activates gene transcription.
Mapping of the Ets-1 Binding Site in the Gelatinase A Promoter to an Evolutionarily Conserved Region
Two approaches were chosen to map the Ets-1 binding site(s)responsible for trans-regulation of the gelatinase A gene. Theflanking sequences of the Ets "GGA" core determine binding specificitiesand affinities of the different Ets-1 family members. To identifythe specific Ets-1 binding sites involved in gelatinase A generegulation, a series of gelatinase A deletion constructs (1µg/well) were cotransfected with the Ets-1 expressionplasmid pEVRF–ets-1 or empty control plasmid (1 µg/well)into rat MC. The lengths of the luciferase deletion constructsare depicted in Figure 5, together with the location of theRE-1 (9). The conserved sequence harboring the potential Ets-1binding site is denoted response element-2 (RE-2; compare Figure 3B).Relative luciferase values were calculated for differencesbetween control and Ets-1–transfected cells, with controlvalues set at 100%. Results were confirmed in three experimentsperformed in triplicate with SD less than 10%. All of the Ets-1–dependenttrans-activation was lost when sequences located between -1004/-1053bps (rat) relative to the translational start site were omitted.Adjacent to the RE-2 motif, another potential Ets-1 bindingmotif is located that shows similarities with the interferon-responsive element (IRE) (21). Notably, the IRE lies outsideof this sequence element and did not confer trans-activation.In addition, the RE-2 was tested for potential cis-regulationwithin the context of the heterologous SV40 promoter. Here,no enhanced trans-activation by co-expressed Ets-1 was detected.These results indicate that Ets-1 trans-activates gelatinaseA transcription in MC via the evolutionarily conserved sequencelocated between -1004/-1053 bps of the rat gelatinase A gene,and this activity is only operative within the context of theintrinsic promoter. A similar stimulatory response was detectedin NRK fibroblasts (22).
Figure 5. Mapping of the rat gelatinase A regulatory sequence for Ets-1 responsive elements. In transient MC transfection studies, a series of promoter deletion constructs were cotransfected with Ets-1 expression plasmid pEVRF–ets-1 to locate responsive elements. Deletion constructs have been described in detail (9). Reporter activities are given as the ratios compared with control transfection with plasmid pEVRF, arbitrarily set as 1. All data represent means of three independent experiments with SD <15%.
To confirm that endogenous Ets-1 binds to this sequence motif,a series of electrophoretic mobility shift analyses were performed.First, a double-stranded oligonucleotide harboring the RE-2sequence was prepared and used for assessment of nuclear proteinbinding. As shown in Figure 6A, a distinct nucleoprotein complexforms with MC nuclear extract and the double-stranded RE-2 asprobe (Figure 6A, lane 2). Upon inclusion of homologous DNAin 100-fold and 500-fold molar excess, complex formation wascompeted, whereas equal amounts of unrelated heterologous DNAdid not affect nucleocomplex formation (compare lanes 3 and5 in Figure 6A). When a mutated oligonucleotide with base changesin the "GGAA" core sequence (GG to TT transition) was used asprobe, no nuclear protein binding was detected (lane 6 in Figure 6A).
Figure 6. Binding of endogenous MC Ets protein(s) to the response element-2 (RE-2). To confirm that endogenous Ets-1 binds to this sequence motif, a series of electrophoretic mobility shift analyses were performed. First, a double-stranded oligonucleotide harboring the RE-2 sequence was prepared and used for assessment of nuclear protein binding. A distinct nucleoprotein complex forms with MC nuclear extract and the double-stranded RE-2 as probe (lane 2 in panel A). With inclusion of homologous (s) DNA in 100-fold and 500-fold molar excess complex formation was competed, whereas unrelated heterologous (ns) DNA did not affect nucleocomplex formation. When a mutated oligonucleotide with base changes in the "GGAA" core sequence was used as probe, no binding could be detected (lane 6). Supershift studies were performed using the specific anti–Ets-1 antibody N276 and an unrelated antibody raised against nuclear factor-1. Inclusion of antibody N276 did not change the mobility of free probe (lane 7), whereas a dramatic change of binding was observed with addition of N276 to the nuclear extract binding reaction, that is the major complex "1>" was no longer detected and a weaker supershifted band, indicated by "2>," was present. At the same time, a major high mobility band appeared (indicated with "3>"). With anti-Ets antibodies C275 and N276, binding studies were performed in the absence (lanes 2 and 3, panel B) and presence of MC nuclear extract (lanes 4 and 5). Addition of antibodies to the nuclear protein binding reactions led to low mobility bands (indicated by "<3") and major high mobility complex (indicated by "<4"). Additional DNA binding studies were performed with potential Ets-1 binding sites from the computerized search. In these studies, no complex formation could be detected (panel C), supporting the importance of the adjacent sequence for binding of Ets transcription.
Supershift studies were performed using the specific anti–Ets-1antibody N276 and an unrelated antibody raised against nuclearfactor-1. Inclusion of antibody N276 did not change the mobilityof free probe (Figure 6A, lane 7), whereas a dramatic changeof binding was observed with addition of N276 to the nuclearextract binding reaction. The major complex "1>" was no longerdetected, and a weaker supershifted band, indicated by "2>,"was present. At the same time, a major high mobility band appeared(indicated by 3>), the identity of which is unclear. Onemay speculate that the anti-Ets antibody stabilizes Ets/DNA-complexformation in the context of the RE-2 probe; however, the detectedsupershift (indicated by *) using antibody N276 confirmed theidentity of Ets-1 in the low mobility complex. A similar setof experiments is shown in Figure 6B, where anti–Ets antibodiesC275 and N276 were tested for binding to the RE-2 probe in theabsence (lanes 2 to 3) and presence of MC nuclear extract (lanes4 to 5). Antibody binding to the DNA probe alone was not detected.When binding reactions of nuclear proteins were performed withthe antibodies, low mobility bands were detected (indicatedby <3) and a similar high mobility complex formed (indicatedby <4). These supershifts are in concordance with endogenousEts-1 binding to the Ets consensus motif present in the RE-2.
Additional DNA binding studies were performed with potentialEts-1 binding sites from the computerized search (compare Figure 3A).In these studies, no complex formation could be detected(Figure 6C), indicating the specificity of Ets-1 binding tothe RE-2 sequence.
Influence of Ets-1 on Gelatinase A Protein Expression
The potential effect of Ets-1 on gelatinase A protein expressionwas analyzed in MC by directly measuring gelatinolytic activitiesafter transfection with either the empty expression plasmidpEVRF (CON, 1 µg/well) or pEVRF–ets-1 (1 µg/well).In the same series of experiments, a known trans-activator ofgelatinase A expression, YB-1, was co-expressed and served aspositive control (23). Transfection efficacy determined by -galactosidasestaining was approximately 30 to 40% (data not shown). Cellculture medium was exchanged 24 h after transfection and substitutedby serum-free albumin–containing medium. Supernatantswere collected after 48 h and assayed for gelatinolytic activitiesby means of zymography. As can be seen in Figure 7A, overexpressionof Ets-1 enhanced gelatinase A synthesis about twofold. YB-1had a similar stimulatory effect on gelatinase A expression.When both plasmids were combined (0.5 µg/well) and introducedinto MC, gelatinase A expression was not synergistically stimulated.Densitometric results of zymography are depicted in Figure 7B.
Figure 7. Gelatinase A synthesis is induced by Ets-1 in rat mesangial cells. Eukaryotic expression plasmids for transcription factors Ets-1 and YB-1 were transiently introduced into rat MC. Plasmid concentrations were 1 µg for respective expression plasmids pEVRF (lanes 1 and 2, panel A), pEVRF-ets-1 (lanes 3 and 4), and pSG5-YB-1 (lanes 5 and 6). For combined pEVRF–ets-1 and pSG5–YB-1 introduction, plasmid concentrations were 0.5 µg each. Care was taken to equalize for total DNA amount by inclusion of empty expression plasmids. Twenty-four hours after transfection, cell culture medium was removed and supplemented by serum-free albumin–containing medium. Conditioned supernatant was collected after 24 h, and gelatinolytic activities were determined by zymography. With Ets-1 or YB-1 overexpression, a significant approximately twofold stimulation of gelatinolytic activity was detected. A similar twofold stimulation was detected with combined YB-1/Ets-1 overexpression. Loading of supernatants were normalized for protein content. Quantification of gelatinolytic activity was performed densitometrically (B). Gelatinolytic activities determined with control plasmids are arbitrarily set as 1.
Ets-1 Expression in Healthy Rat Kidney and in Mesangioproliferative Glomerular Disease
In a previous study performed by Naito et al. (24), MC Ets-1expression has not significantly been detected by immunohistochemistryin healthy kidney as well as in a rat model of accelerated nephrotoxicserum-induced anti-GBM nephritis. Contrary to these findings,immunohistochemistry using the monospecific anti–Ets-1antibody N-276 (Santa Cruz Biotechnology), which does not crossreactwith other Ets family members, demonstrated a heterogeneousdistribution of Ets-1–positive cells in healthy rat kidneys(CON) with staining of glomerular, tubular, and vascular cells(Figure 8). Exclusively nuclear staining was detected. Controlsthat included incubation with a nonspecific primary antibodyshowed no staining (not shown). On day 7 after induction ofthe anti–Thy-1.1 glomerulonephritis, profound changesof Ets-1 protein expression were detected. In these experiments,a counterimmuno-staining for -smooth muscle actin was performedto identify MC. Ets-1 staining was intense in MC, whereas podocyteand EC staining was rather unchanged (Figure 8), suggestingthat MC Ets-1 expression is upregulated in this model.
Figure 8. Immunostaining for Ets-1 in control Sprague Dawley rats and with mesangioproliferative glomerulonephritis. The distribution of Ets-1–positive cells in healthy rat kidneys (CON) was heterogeneous with exclusively nuclear staining of glomerular, tubular, and vascular cells. Profound changes of its expression were detected in the anti-Thy-1.1 glomerulonephritis (d7): Ets-1 staining was intense in MC, whereas podocyte and EC staining was unchanged. A counter-stain for -smooth muscle actin identifies MC origin on day 7 after disease induction.
Members of the large Ets transcription factor family are expressedby many tissues and are highly regulated at different stagesduring development. Ets-1 expression is not developmentallyrestricted (25) and is involved in as different processes asangiogenesis, inflammation, and tumorigenesis. Original workindicated a direct influence of Ets-1 expression on T cell commitment(26,27); however, recent work also shows highly regulated expressionin nonhematopoietic tissues. Ets-1 expression has been observedin human embryos and granulation tissue and during tumor vascularization(28). Furthermore, Ets-1 is widely expressed during cardiacmorphogenesis, a process accompanied by cell transdifferentiationand migration. Ets-1 may, in this process, trans-activate anumber of genes involved in degradation of extracellular matricesand cell migration (29). In EC lines, angiogenic propertiesare correlated with elevated levels of Ets-1 and matrix metalloproteinases1, 3 and 9, as well as integrin beta 3. Invasiveness was enhancedin high Ets-1–expressing cells and reduced in low Ets-1–expressingcells (30,31). The presented results demonstrate the constitutiveexpression of Ets-1 by cultured MC. Cross-reactive Western blottingusing a polyclonal anti–Ets-1 antibody suggests that additional,as yet uncharacterized Ets-related proteins are also expressedby MC, the masses of which are approximately 15, 33, and 65kD. Among the known Ets family members, approximate sizes of65 kD have been reported for Elf-1 and PEA3. Another memberof the Ets protein family, PU.1, with a calculated molecularweight of 30.7 kD has recently been identified in MC as negativeregulator of gelatinase A transcription that acts via an upstreamsilencer element (11). Ets transcription factors with molecularsizes of 15 kD have not been described, suggesting that thisband constitutes a proteolytic cleavage product. We are currentlyattempting to characterize the other Ets proteins using an expressioncloning strategy.
Our study adds the gelatinase A gene as another Ets-1 target.The human and rat 5' regulatory sequences of the gelatinaseA genes display little similarities with other members of theMMP gene family (9) and lack a TATA-box within the proximalpromoter and regulatory elements for transcription factor NF-B.Extensive fine mapping of the human and rat gelatinase A genefor regulatory elements in different cell-types has been performedand demonstrate a complex pattern of transcriptional regulationthrough the action of several, cell-type specific cis-elementsacting in concert with the homologous promoter (9,11,32,33).The enhancer element RE-1 at -1282 bp relative to the translationalstart site is responsible for about 80% of the trans-activityrequired for constitutive gelatinase A expression by culturedMC (9), with specific binding of transcription factors AP2,YB-1, and p53 (9,10,12,23,32). Conserved Ets-1/PEA3 elementsthat bind several members of Ets transcription factors havebeen found in all inducible MMP promoters. With the exceptionof MMP-12 these Ets-1/PEA3 elements are located adjacent toat least one AP-1 complex binding site. Ets-1 involvement ingelatinase A gene transcription was suggested by two observations:(1) several putative Ets-1 binding sites are present in thegelatinase A regulatory sequence; and (2) these sequences areconserved in the human and rat genes. In the present studies,MC nuclear Ets-1 was readily able to bind to a Ets-1 consensusoligonucleotide as well as to the RE-2 binding site. Bindingspecificity to the purine rich Ets-1/PEA3 element A/CGGAA/Tis determined by flanking sequences (34,35). Ets proteins donot usually dimerize and bind to DNA alone but preferentiallyform complexes with other transcription factors, e.g., AP-1,for which they function as coactivators (34,36). AP-1 bindingsites are not present in the vicinity of the RE-2; however,the results obtained with DNA binding studies suggest the presenceof interacting proteins and direct interactions with homologouspromoter elements were required for Ets-1 trans-activation inMC.
Given our knowledge concerning the role of gelatinase A in thetransition of MC into the "activated" phenotype, trans-activationof gelatinase A gene transcription by Ets-1 may be of importancein the inflammatory response. Ets-1 is a potential key playerin the molecular program responsible for the prosclerotic MCphenotype by virtue of its target genes that include, amongothers, genes involved in cell-cycle progression (30,37) andextracellular matrix synthesis, e.g., extracellular matrix proteinsosteopontin and tenascin (38). In addition, enzymes involvedin extracellular matrix degradation and remodeling, collagenase-1(MMP-1) (39), stromelysin (MMP-3) (30), and 92-kD type IV collagenase(MMP-9) (40) are also regulated by Ets-1. Given the observationof increased Ets-1 expression in a rat model of mesangioproliferativeglomerulonephritis, in which increased gelatinase A expressionhas been demonstrated with MC activation (4), transcriptionfactor Ets-1 has the potential of being critically involvedin the progression of inflammatory glomerular disease.
Acknowledgments
We are grateful to the following people for kindly providingplasmid constructs: Barbara Graves (University of Utah, SaltLake City, UT) for Ets-1 plasmid, Jenny P. Ting (Universityof North Carolina, Chapel Hill, NC) for YB-1 plasmid. We alsothank Monika Cordes for excellent technical assistance. Thiswork was supported by the Deutsche Forschungsgemeinschaft (SFB542 project C4 to PRM and project C7 to JF) and National Institutesof Health grant DK39776 to DHL.
Klahr S, Schreiner G, Ichikawa I: The progression of renal disease. N Engl J Med 318: 1657–1666. 1988[Abstract]
Johnson RJ, Floege J, Yoshimura A, Iida H, Couser WG, Alpers CE: The activated mesangial cell: a glomerular "myofibroblast"? J Am Soc Nephrol 2: S190–S197, 1992[Abstract]
Harendza S, Schneider A, Helmchen U, Stahl RA: Extracellular matrix deposition and cell proliferation in a model of chronic glomerulonephritis in the rat. Nephrol Dial Transplant 14: 2873–2879, 1999[Abstract/Free Full Text]
Lovett DH, Johnson RJ, Marti HP, Martin J, Davies M, Couser WG: Structural characterization of the mesangial cell type IV collagenase and enhanced expression in a model of immune complex-mediated glomerulonephritis. Am J Pathol 141: 85–98, 1992[Abstract]
Woessner JF Jr: The family of matrix metalloproteinases. Ann N Y Acad Sci 732: 11–21, 1994[Medline]
Westermarck J, Kahari VM: Regulation of matrix metalloproteinase expression in tumor invasion. Faseb J 13: 781–792, 1999[Abstract/Free Full Text]
Turck J, Pollock AS, Lee LK, Marti HP, Lovett DH: Matrix metalloproteinase 2 (gelatinase A) regulates glomerular mesangial cell proliferation and differentiation. J Biol Chem 271: 15074–15083, 1996[Abstract/Free Full Text]
Turck J, Pollock AS, Lovett DH: Gelatinase A is a glomerular mesangial cell growth and differentiation factor. Kidney Int 51: 1397–1400, 1997[Medline]
Harendza S, Pollock AS, Mertens PR, Lovett DH: Tissue-specific enhancer-promoter interactions regulate high level constitutive expression of matrix metalloproteinase 2 by glomerular mesangial cells. J Biol Chem 270: 18786–18796, 1995[Abstract/Free Full Text]
Mertens PR, Alfonso-Jaume MA, Steinmann K, Lovett DH: YB-1 regulation of the human and rat gelatinase A genes via similar enhancer element: J Am Soc Nephrol 10: 2480–2487, 1999[Abstract/Free Full Text]
Harendza S, Lovett DH, Stahl RA: The hematopoietic transcription factor PU.1 represses gelatinase A transcription in glomerular mesangial cells [in process citation]. J Biol Chem 275: 19552–1955.9, 2000[Abstract/Free Full Text]
Mertens PR, Harendza S, Pollock AS, Lovett DH: Glomerular mesangial cell-specific transactivation of matrix metalloproteinase 2 transcription is mediated by YB-1. J Biol Chem 272: 22905–22912, 1997[Abstract/Free Full Text]
Banas B, Luckow B, Moller M, Klier C, Nelson PJ, Schadde E, Brigl M, Halevy D, Holthofer H, Reinhart B, Schlondorff D: Chemokine and chemokine receptor expression in a novel human mesangial cell line. J Am Soc Nephrol 10: 2314–2322, 1999[Abstract/Free Full Text]
Bojovic BB, Hassell JA: The PEA3 Ets transcription factor comprises multiple domains that regulate transactivation and DNA binding. J Biol Chem 276: 4509–4521, 2001[Abstract/Free Full Text]
Keogh MC, Chen D, Lupu F, Shaper N, Schmitt JF, Kakkar VV, Lemoine NR: High efficiency reporter gene transfection of vascular tissue in vitro and in vivo using a cationic lipid-DNA complex. Gene Ther 4: 162–171, 1997[CrossRef][Medline]
Johnson RJ, Garcia RL, Pritzl P, Alpers CE: Platelets mediate glomerular cell proliferation in immune complex nephritis induced by anti-mesangial cell antibodies in the rat. Am J Pathol 136: 369–374, 1990[Abstract]
Kliem V, Johnson RJ, Alpers CE, Yoshimura A, Couser WG, Koch KM, Floege J: Mechanisms involved in the pathogenesis of tubulointerstitial fibrosis in 5/6-nephrectomized rats. Kidney Int 49: 666–678, 1996[Medline]
Cowley DO, Graves BJ: Phosphorylation represses Ets-1 DNA binding by reinforcing autoinhibition. Genes Dev 14: 366–376, 2000[Abstract/Free Full Text]
Quandt K, Frech K, Karas H, Wingender E, Werner T: MatInd and MatInspector: New fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23: 4878–4884, 1995[Abstract/Free Full Text]
Rutherford MN, Kumar A, Haque SJ, Ghysdael J, Williams BR: Specific binding of the ETS-domain protein to the interferon-stimulated response element. J Interferon Cytokine Res 17: 1–10, 1997[Medline]
Norman JT, Lindahl GE, Shakib K, En-Nia A, Yilmaz E, Mertens PR: The Y-box binding protein YB-1 suppresses collagen 1(I) gene transcription via an evolutionarily conserved regulatory element in the proximal promoter. J Biol Chem 6: 6, 2001
Mertens PR, Alfonso-Jaume MA, Steinmann K, Lovett DH: A synergistic interaction of transcription factors AP2 and YB-1 regulates gelatinase A enhancer-dependent transcription. J Biol Chem 273: 32957–32965, 1998[Abstract/Free Full Text]
Naito T, Razzaque MS, Nazneen A, Liu D, Nihei H, Koji T, Taguchi T: Renal expression of the Ets-1 proto-oncogene during progression of rat crescentic glomerulonephritis. J Am Soc Nephrol 11: 2243–2255, 2000[Abstract/Free Full Text]
Meyer D, Durliat M, Senan F, Wolff M, Andre M, Hourdry J, Remy P: Ets-1 and Ets-2 proto-oncogenes exhibit differential and restricted expression patterns during Xenopus laevis oogenesis and embryogenesis. Int J Dev Biol 41: 607–620, 1997[Medline]
Anderson MK, Hernandez-Hoyos G, Diamond RA, Rothenberg EV: Precise developmental regulation of Ets family transcription factors during specification and commitment to the T cell lineage. Development 126: 3131–3148, 1999[Abstract]
Barton K, Muthusamy N, Fischer C, Ting CN, Walunas TL, Lanier LL, Leiden JM: The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity 9: 555–563, 1998[CrossRef][Medline]
Wernert N, Stanjek A, Kiriakidis S, Hugel A, Jha HC, Mazitschek R, Giannis A: Inhibition of angiogenesis in vivo by ets-1 antisense oligonucleotides—inhibition of Ets-1 transcription factor expression by the antibiotic fumagillin. Angew Chem Int Ed Engl 38: 3228–3231, 1999[CrossRef][Medline]
Macias D, Perez-Pomares JM, Garcia-Garrido L, Carmona R, Munoz-Chapuli R: Immunoreactivity of the ets-1 transcription factor correlates with areas of epithelial-mesenchymal transition in the developing avian heart. Anat Embryol (Berl) 198: 307–315, 1998[CrossRef][Medline]
Oda N, Abe M, Sato Y: ETS-1 converts endothelial cells to the angiogenic phenotype by inducing the expression of matrix metalloproteinases and integrin beta3. J Cell Physiol 178: 121–132, 1999[CrossRef][Medline]
Tanaka K, Oda N, Iwasaka C, Abe M, Sato Y: Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol 176: 235–244, 1998[CrossRef][Medline]
Bian J, Sun Y: Transcriptional activation by p53 of the human type IV collagenase (gelatinase A or matrix metalloproteinase 2) promoter. Mol Cell Biol 17: 6330–6338, 1997[Abstract]
Bottles KD, Bullen EC, Updike DL, Vu TK, Phelps E, Grammas P, Howard EW: Gelatinase A expression in endothelial cells is regulated by at least two cis-acting promoter elements. Biochim Biophys Acta 1428: 147–160, 1999[Medline]
Sharrocks AD, Brown AL, Ling Y, Yates PR: The ETS-domain transcription factor family. Int J Biochem Cell Biol 29: 1371–1387, 1997[CrossRef][Medline]
Pio F, Assa-Munt N, Yguerabide J, Maki RA: Mutants of ETS domain PU.1 and GGAA/T recognition: Free energies and kinetics. Protein Sci 8: 2098–2109, 1999[Abstract]
Carrere S, Verger A, Flourens A, Stehelin D, Duterque-Coquillaud M: Erg proteins, transcription factors of the Ets family, form homo, heterodimers and ternary complexes via two distinct domains. Oncogene 16: 3261–3268, 1998[CrossRef][Medline]
de Nigris F, Mega T, Berger N, Barone MV, Santoro M, Viglietto G, Verde P, Fusco A: Induction of ETS-1 and ETS-2 transcription factors is required for thyroid cell transformation. Cancer Res 61: 2267–2275, 2001[Abstract/Free Full Text]
Hultgardh-Nilsson A, Cercek B, Wang JW, Naito S, Lovdahl C, Sharifi B, Forrester JS, Fagin JA: Regulated expression of the ets-1 transcription factor in vascular smooth muscle cells in vivo and in vitro. Circ Res 78: 589–595, 1996[Abstract/Free Full Text]
Logan SK, Garabedian MJ, Campbell CE, Werb Z: Synergistic transcriptional activation of the tissue inhibitor of metalloproteinases-1 promoter via functional interaction of AP-1 and Ets-1 transcription factors. J Biol Chem 271: 774–782, 1996[Abstract/Free Full Text]
Sato H, Seiki M: Regulatory mechanism of 92 kDa type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene 8: 395–405, 1993[Medline]
Received for publication November 26, 2001.
Accepted for publication February 7, 2002.
This article has been cited by other articles:
A. Munkert, U. Helmchen, M. J. Kemper, M. Bubenheim, R. A. K. Stahl, and S. Harendza Characterization of the transcriptional regulation of the human MT1-MMP gene and association of risk reduction for focal-segmental glomerulosclerosis with two functional promoter SNPs
Nephrol. Dial. Transplant.,
October 16, 2008;
(2008)
gfn576v1.
[Abstract][Full Text][PDF]
M. A. Alfonso-Jaume, M. R. Bergman, R. Mahimkar, S. Cheng, Z. Q. Jin, J. S. Karliner, and D. H. Lovett Cardiac ischemia-reperfusion injury induces matrix metalloproteinase-2 expression through the AP-1 components FosB and JunB
Am J Physiol Heart Circ Physiol,
October 1, 2006;
291(4):
H1838 - H1846.
[Abstract][Full Text][PDF]
S. Cheng, A. S. Pollock, R. Mahimkar, J. L. Olson, and D. H. Lovett Matrix metalloproteinase 2 and basement membrane integrity: a unifying mechanism for progressive renal injury
FASEB J,
September 1, 2006;
20(11):
1898 - 1900.
[Abstract][Full Text][PDF]
T. Naito, Y. Tanihata, H. Nishimura, T. Tanaka, C. Higuchi, T. Taguchi, and T. Sanaka Expression of matrix metalloproteinase-9 associated with ets-1 proto-oncogene in rat tubulointerstitial cells
Nephrol. Dial. Transplant.,
November 1, 2005;
20(11):
2333 - 2348.
[Abstract][Full Text][PDF]
A. En-Nia, E. Yilmaz, U. Klinge, D. H. Lovett, I. Stefanidis, and P. R. Mertens Transcription Factor YB-1 Mediates DNA Polymerase {alpha} Gene Expression
J. Biol. Chem.,
March 4, 2005;
280(9):
7702 - 7711.
[Abstract][Full Text][PDF]
G Eisenhofer, T-T Huynh, K Pacak, F M Brouwers, M M Walther, W M Linehan, P J Munson, M Mannelli, D S Goldstein, and A G Elkahloun Distinct gene expression profiles in norepinephrine- and epinephrine-producing hereditary and sporadic pheochromocytomas: activation of hypoxia-driven angiogenic pathways in von Hippel-Lindau syndrome
Endocr. Relat. Cancer,
December 1, 2004;
11(4):
897 - 911.
[Abstract][Full Text][PDF]
H. Tanaka, Y. Terada, T. Kobayashi, T. Okado, S. Inoshita, M. Kuwahara, A. Seth, Y. Sato, and S. Sasaki Expression and Function of Ets-1 during Experimental Acute Renal Failure in Rats
J. Am. Soc. Nephrol.,
December 1, 2004;
15(12):
3083 - 3092.
[Abstract][Full Text][PDF]
H. Ito, M. Duxbury, E. Benoit, T. E. Clancy, M. J. Zinner, S. W. Ashley, and E. E. Whang Prostaglandin E2 Enhances Pancreatic Cancer Invasiveness through an Ets-1-Dependent Induction of Matrix Metalloproteinase-2
Cancer Res.,
October 15, 2004;
64(20):
7439 - 7446.
[Abstract][Full Text][PDF]
e 30, 52057 Aachen, Germany. Phone: +49-241-8089532; Fax: +49-241-8082446; E-mail: Pmertens{at}ukaachen.de
Top
Abstract
Introduction
-2P]ATP and were purified on 14% polyacrylamide gels and eluted, and 6 x 104 cpm of labeled probe was included per binding reaction. Binding reactions were performed at 22°C for 30 min in binding buffer (20 mM HEPES [pH 7.9], 20% glycerol, 0.1 M NaCl, 0.2 mM EDTA) containing 0.2 mM PMSF, 0.5 mM DTT, 300 µg/ml acetylated BSA, and 2 µg of poly(dI-dC) in a total volume of 25 µl upon addition of nuclear or cytoplasmic extracts (15 µg total protein/binding reaction if not otherwise indicated). Samples were electrophoresed on nondenaturing 4% polyacrylamide, 7.5% glycerol gels in a buffer containing 1 x Tris/borate/EDTA before autoradiography. 
-smooth muscle actin. Negative controls consisted of substitution of the primary antibody with equivalent concentrations of normal rabbit IgG. Double immunostaining for the identification of Ets-1–expressing MC was performed as reported (18) by first staining the sections for Ets-1 with an anti–Ets-1 antibody (N-276, Santa Cruz Biotechnology) using an indirect immunoperoxidase procedure. Sections were then incubated with the IgG1 monoclonal antibody 1A4 against 
B. Extensive fine mapping of the human and rat gelatinase A gene for regulatory elements in different cell-types has been performed and demonstrate a complex pattern of transcriptional regulation through the action of several, cell-type specific cis-elements acting in concert with the homologous promoter (9,11,32,33). The enhancer element RE-1 at -1282 bp relative to the translational start site is responsible for about 80% of the trans-activity required for constitutive gelatinase A expression by cultured MC (9), with specific binding of transcription factors AP2, YB-1, and p53 (9,10,12,23,32). Conserved Ets-1/PEA3 elements that bind several members of Ets transcription factors have been found in all inducible MMP promoters. With the exception of MMP-12 these Ets-1/PEA3 elements are located adjacent to at least one AP-1 complex binding site. Ets-1 involvement in gelatinase A gene transcription was suggested by two observations: (1) several putative Ets-1 binding sites are present in the gelatinase A regulatory sequence; and (2) these sequences are conserved in the human and rat genes. In the present studies, MC nuclear Ets-1 was readily able to bind to a Ets-1 consensus oligonucleotide as well as to the RE-2 binding site. Binding specificity to the purine rich Ets-1/PEA3 element A/CGGAA/T is determined by flanking sequences (34,35). Ets proteins do not usually dimerize and bind to DNA alone but preferentially form complexes with other transcription factors, e.g., AP-1, for which they function as coactivators (34,36). AP-1 binding sites are not present in the vicinity of the RE-2; however, the results obtained with DNA binding studies suggest the presence of interacting proteins and direct interactions with homologous promoter elements were required for Ets-1 trans-activation in MC. 
