 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*Division of Nephrology, Nanfang Hospital, Guangzhou, People’s Republic of China; Department of Surgery, Columbia University, College of Physicians and Surgeons, New York, New York; and Institute of Renal Outcomes Research and Health Policy, Duke University Medical Center, Durham, North Carolina.
Correspondence to Dr. Fan Fan Hou, Division of Nephrology, Nanfang Hospital. Guangzhou 510515, P. R. China. Phone: +86-20-85141591; Fax: +86-20-87281713; E-mail: ffhou{at}public.guangzhou.gd.cn
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-microglobulin (2m) modified with advanced glycation end products (AGE). The amyloid deposits are located principally in joint structures, with adjacent chronic inflammatory reaction characterized by monocyte infiltration. This study examined the interaction of AGE-2m with human synovial fibroblasts and investigated the proinflammatory effects of that interaction. It was demonstrated that human synovial fibroblasts constitutively expressed the receptor for AGE (RAGE). RAGE expression was detected mainly in synovial intima and was upregulated in DRA synovium. 125I-AGE-2m bound to immobilized human synovial fibroblasts in a specific, dose-dependent manner (Kd of approximately 138.0 nM), and binding was inhibited by anti-RAGE IgG. Incubation of human synovial fibroblasts with AGE-2m induced degradation of this AGE-modified protein, as well as increased monocyte chemoattractant protein-1 (MCP-1) mRNA and protein expression. The amount of MCP-1 produced by AGE-2m-stimulated human synovial fibroblasts was sufficient to induce the chemotaxis of monocytes. MCP-1 synthesis resulted from engagement of RAGE, because the increase in MCP-1 synthesis was attenuated by preincubation of human synovial fibroblasts with anti-RAGE IgG. These data provide evidence of RAGE-mediated perturbation of human synoviocytes, which may be involved in the pathogenesis of inflammatory processes associated with DRA. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-microglobulin (2m) (3), are located mainly in joints and periarticular bones and can result in carpal tunnel syndrome, periarticular bone cysts, and destructive spondyloarthropathy (1,2,4).
The pathogenesis of DRA is incompletely understood. Although recent histologic studies demonstrated the accumulation of monocytes/macrophages around amyloid deposits (5,6), the factors causing their infiltration and pathologic involvement have yet to be fully elucidated. Because 2m is a major constituent of amyloid fibrils, it has been the target molecule in some efforts to elucidate the pathogenesis of DRA. However, no correlation between serum levels of 2m and the occurrence of DRA has been observed (7,8).
Recent studies demonstrated that advanced glycation end products (AGE), formed by nonenzymatic Maillard reactions between proteins and carbohydrates, are present in 2m amyloid fibrils in DRA (9,10). In diseases such as diabetes mellitus and Alzheimer’s disease, excessive deposition of these covalent adducts has been demonstrated to contribute to tissue injury via direct chemical crosslinking, as well as through cell surface receptor-mediated pathways (11). Articular structures, such as the synovium, are the predominant sites of early 2m amyloid deposition. The synovial intima consists of macrophage-like (type A) and fibroblast-like (type B) cells (12). Synovial fibroblasts, which account for 70% of the cellular constituents of the synovial intima (12), are exposed directly to AGE-modified 2m (AGE-2m) during the natural history of DRA. Our previous identification of the receptor for AGE (RAGE) on human skin fibroblasts (13) led us to postulate that synovial fibroblasts might be a direct target for the agonist actions of AGE-2m. On the basis of this hypothesis, we examined the interaction of AGE-2m with human synovial fibroblasts and investigated the proinflammatory effects of this interaction.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Identification of RAGE on Human Synovial Fibroblasts
Immunofluorescence Analyses.
Human synovial fibroblasts were allowed to adhere to 12-mm coverslips for 2 h at 37°C. The cells were then washed with phosphate-buffered saline (PBS) (pH 7.4) and fixed in 2% paraformaldehyde. Fixed synovial fibroblasts were incubated with rabbit anti-human RAGE (40 µg/ml) (13,18) or nonimmune rabbit IgG (40 µg/ml) for 60 min at 37°C. After washing of the primary antibody, the surface distribution of the primary antibody was detected with FITC-conjugated goat anti-rabbit IgG (Sigma).
Immunohistochemical Analyses.
Synovial samples were obtained from healthy subjects (n = 5; mean age, 51 yr) and from nondiabetic patients with DRA (n = 4; mean age, 60 yr) who had undergone hemodialysis for 7 to 12 yr. DRA synovial samples were obtained during surgical intervention (carpal tunnel release or rotator cuff repair). Tissue samples were snap-frozen in OCT compound (Life Sciences International, Chesire, England) within 30 min after collection and were stored at -70°C. Frozen tissue sections (6 µm) were air-dried at room temperature, on poly-L-lysine-coated glass slides, for 6 to 16 h. Sections were fixed in chloroform/acetone (1:1) for 10 min at room temperature, air-dried, and rehydrated in 0.05 M Tris-HCl for 3 min.
Serial sections of each specimen were subjected to both single and double immunohistochemical analyses with the Dako EnVision double-stain system (Dako, Glostrup, Denmark), according to the technical guidelines provided by the manufacturer. Single immunohistochemical analyses were performed for 2m and CD68. 2m amyloid deposits were identified on the basis of alkaline Congo Red and anti-2m (dilution, 1/100; Dako) staining. Monocyte/macrophage infiltration was identified on the basis of anti-CD68 (dilution, 1/50; Dako) staining. Double immunohistochemical analyses were performed for vimentin and RAGE, CD68 and RAGE, and RAGE and monocyte chemoattractant protein-1 (MCP-1). The primary antibodies used in the study were as follows: mouse anti-human vimentin (dilution, 1/50; Dako), rabbit anti-human RAGE (40 µg/ml), mouse anti-human CD68 (dilution, 1/50; Dako), and mouse anti-human MCP-1 (dilution, 1/40; PharMingen, San Diego, CA). The following controls were always included: anti-vimentin and mouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA), anti-CD68 and mouse IgG1 (Phar-mingen), and RAGE and rabbit IgG.
Cell Membrane Extraction and Western Blotting.
Cell membrane-enriched fractions were prepared as described previously (19). Synovial fibroblast monolayers were detached with PBS containing EDTA (5 mM), centrifuged, and resuspended in lysis buffer [PBS containing 200 mM Hepes, 1 mM EDTA, 300 mM KCl, 3 mM MgCl2, and protease inhibitors (2 mM phenylmethylsulfonyl fluoride, 5 µg/ml leupeptin, and 10 µg/ml aprotinin)]. Cells were homogenized at 4°C, and unbroken cells were removed after centrifugation at 12,000 x g for 10 min at 4°C. The supernatants were subjected to further centrifugation at 97,000 x g for 1 h. The membrane-enriched pellets were resuspended in lysis buffer.
For Western blot analysis, the cell membrane extracts (20 µg of protein/lane) were subjected to electrophoresis on 12% sodium dodecyl sulfate (SDS)-Tris-glycine gels (BioRad, Hercules, CA), under reducing conditions, and were electroblotted onto nitrocellulose membranes (BioRad). Nonspecific binding sites were blocked with 5% albumin solution. The primary rabbit anti-RAGE antibody (45 µg/ml), in PBS containing 0.05% Tween-20, was added to the blots and incubated at room temperature for 2 h. Nonimmune rabbit IgG was used as a negative control. At the end of the incubation, a peroxidase-conjugated, secondary anti-rabbit IgG antibody (IgG) was added and the blots were developed with ECL reagents (Amersham, Arlington Heights, IL).
Reverse Transcription-PCR.
Synovial fibroblasts were detached and washed. Total RNA was extracted by using a single-step method of RNA isolation via acid guanidinium-thiocyanate-phenol-chloroform extraction (20). RNA contents were measured, and 5 µg of RNA was added to reverse transcription (RT) reactions, which were performed by using a first-strand cDNA synthesis kit (Genset, Singapore). A sample of cDNA was then placed in a PCR instrument (with Taq polymerase and dNTP purchased from Genset). The specific primer pairs for RAGE were as follows: sense, AGGCCCTCCAGTACTACT; antisense, GGGCAGCCGGAACAGCAGTTG (Institute of Biophysics of China, Peking, China). The expected size of the RT-PCR product was 1.2 kb. The PCR included 32 cycles. After PCR, the products were separated on a 1% agarose gel and stained with ethidium bromide. At least three RT-PCR were performed, using synovial fibroblasts from different isolations.
Preparation of AGE-Modified Proteins
AGE-modified proteins were prepared in vitro as described previously (13). Briefly, 1.75 mg/ml purified normal human 2m (Cortex Biochem, San Leandro, CA) or normal human serum albumin (HSA) (Sigma) was incubated at 37°C for 56 d with 200 mM D-glucose in 100 mM phosphate buffer containing 200 U/ml penicillin, 70 µg/ml gentamicin, and 1.5 mM phenylmethylsulfonyl fluoride. Samples incubated in an identical manner in the absence of glucose were used as controls. After incubation, all samples were dialyzed against PBS (pH 7.4). Endotoxin was removed from the samples as described previously (21). AGE-modified proteins were characterized by using an enzyme-linked immunosorbent assay (ELISA) and fluorospectrometry, as described (22). The AGE content was quantitated fluorospectrometrically. The AGE content for AGE-2m was 66.3 U/mg protein, that for AGE-HSA was 70.1 U/mg protein, and that for both 2m and HSA controls was 0.9 U/mg protein. Endotoxin levels in all samples were measured with an E-toxat kit (Sigma) and were found to be below the limit of detection (<0.5 U/ml).
125I-AGE-2m Binding Assays
AGE-2m was radiolabeled by using the Iodo-Gen method (23), with carrier-free 125I (Institute of Atomic Energy of China, Peking, China). Samples were dialyzed against 0.01 M phosphate (pH 7.0)/0.15 M NaCl until >95% of the radioactivity was TCA-precipitable and the samples were free of iodide. Protein concentrations were determined by using the BioRad assay (BioRad).
For binding studies, synovial fibroblasts (2 x104/well) were seeded onto 24-well plates and incubated overnight. Cells were then washed with binding buffer (Hanks’ buffered salt solution containing 0.02% FCS and 25 mM Hepes) and incubated with the indicated concentrations of radiolabeled AGE-2m, in the presence or absence of a 25-fold molar excess of unlabeled AGE-2m or nonglycated 2m, for 3 h at 4°C. Where indicated, synovial fibroblasts were preincubated with the indicated concentrations of rabbit anti-human RAGE antibody or nonimmune rabbit IgG for 2 h at 4°C, before addition of radiolabeled AGE-2m. At the end of the incubation, the radioligand-containing medium was aspirated. The cells were washed three times with fresh medium, lysed by addition of 0.1 M NaOH, and counted in a 
-counter (LKB, Gaithersburg, MD). Specific binding was calculated as the difference between total and nonspecific (the radioligand bound in the presence of a 25-fold molar excess of unlabeled ligand) binding. Transformation of saturation binding data was performed according to the method described by Vlassara (23), for estimation of the receptor number and binding affinity constant.
For determination of 125I-AGE-2m uptake and degradation by synovial fibroblasts, monolayers were washed with DMEM containing 0.02% FCS and 25 mM Hepes and were incubated with 125I-AGE-2m (50 µg) at 37°C for 22 h, in the presence or absence of unlabeled AGE-2m. Culture supernatants were collected and precipitated with an equal volume of 20% TCA. The amount of cell-degraded 125I-AGE-2m was calculated from the non-TCA-precipitable radioactivity value, as described previously (24).
MCP-1 Protein and mRNA Analyses
Cell Preparation.
Human synovial fibroblasts isolated from each patient were plated at 5 x104 cells/well in 24-well plates and were grown in DMEM with 10% FCS for 3 d, until confluent. The medium was changed to DMEM supplemented with 0.2% lactalbumin (Life Technologies) and 0.05% (vol/vol) lipids (Sigma) for 18 h; the cells were then incubated in the same medium with increasing concentrations of AGE-2m, AGE-HSA, native HSA, or unmodified 2m. In separate experiments, synovial fibroblasts were preincubated with 5.0 µg/ml rabbit anti-human RAGE or nonimmune rabbit IgG for 2 h at 4°C. The cells were washed with DMEM with 0.2% lactalbumin and incubated for 48 h with AGE-2m (50 µg/ml). At the end of the incubations, the supernatants were collected for quantitation of MCP-1. The corresponding monolayers were washed and trypsinized, and the cells were counted.
ELISA.
The levels of MCP-1 in the supernatants were quantitated with a sandwich ELISA, as described previously (25). Briefly, plates were coated with a mouse anti-human MCP-1 monoclonal antibody (5-D3-F7; PharMingen), at a concentration of 5 µg/ml, for 12 h at 4°C. Nonspecific binding sites were blocked with 0.3% (wt/vol) gelatin in PBS containing 0.05% (vol/vol) Tween 20, and the wells were incubated for 60 min at room temperature with a polyclonal rabbit anti-human MCP-1 antibody (PharMingen), at a concentration of 2 µg/ml. After washing, the wells were incubated for 60 min with peroxidase-conjugated goat anti-rabbit IgG (PharMingen), followed by addition of the substrate diaminobenzidine. The absorbance at 450 nm was measured with a spectrophotometer. With recombinant human MCP-1 (PharMingen), the standard concentration curve for MCP-1 was linear from 0.3 to 3 ng/ml, as measured by ELISA.
Northern Blot Analyses.
Human synovial fibroblasts were incubated with 50 µg/ml AGE-2m, AGE-HSA, unmodified 2m, or unmodified HSA for 48 h. RNA was extracted with TRIZOL (Life Technologies) (20). Twenty micrograms of total RNA were subjected to electrophoresis in each lane of an agarose/formaldehyde gel, transferred to nitrocellulose membranes, and hybridized with a 32P-labeled cDNA probe for human MCP-1 (American Type Culture Collection, Manassas, VA) at 42°C for 16 h. After hybridization, the membranes were washed twice with 2x SSC/0.1% SDS at room temperature for 30 min each time and twice with 0.1x SSC/0.1% SDS at 50°C for 15 min each time. The membranes were exposed to x-ray film (Kodak, Xiamen, China). The autoradiographs were scanned, and densitometric analysis was performed by using metamorphic software (Universal Imaging Corp., England). The membranes were striped and reprobed for glyceraldehyde-3-phosphate dehydrogenase, for comparison of RNA loading.
Monocyte Chemotaxis Assay
Chemotaxis assays were performed in 48-well microchemotaxis chambers (Neuro-Probe, Bethesda, MD) containing polycarbonate membranes (5 µm; Nucleopore, Pleasanton, CA), using human peripheral blood-derived monocytes (18). Monocytes were suspended in RPMI 1640 medium containing 1% FCS. Ten thousands cells/well were added to the upper chamber, and the lower chamber contained MCP-1 (4.4 ng/ml), medium alone (negative controls), or 10-6 M formylmethionylleucylphenylalanine (positive controls). Assays were performed in triplicate or quadruplicate with a 4-h incubation period at 37°C, after which nonmigrating cells were removed, membranes were fixed in methanol, and migrating cells were observed with Wright’s stain. Cells in nine high-power fields were counted. The experiment was repeated three times, using monocytes from three healthy volunteers.
Statistical Analyses
All experiments were performed in triplicate. Continuous variables, expressed as mean ± SD, were compared by using ANOVA. Multiplicative terms were included for evaluation of interactions among explanatory variables. The Student-Newman-Keuls procedure was used to evaluate pairwise comparisons. Two-tailed P values of <0.05 were considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
2m amyloid deposits were observed in synovial specimens from hemodialysis patients but not in specimens from healthy subjects. Monocyte/macrophage infiltration was present in all DRA tissue samples. RAGE immunoreactivity was present on synovial intimal fibroblasts and some subintimal fibroblasts (Figure 2A). In synovial sections from patients with DRA, RAGE immunoreactivity was markedly enhanced on fibroblasts (Figure 2C) and was observed on monocytes/macrophages surrounding the amyloid deposits (Figure 2F). No immunostaining of synovium from either healthy subjects or patients with DRA was evident with nonimmune IgG (Figure 2, B, E, F, H, and I).
|
|
To demonstrate the transcription of RAGE in synovial fibroblasts, RAGE mRNA expression was analyzed by RT-PCR. A signal was observed for isolated human synovial fibroblasts (Figure 3C, lane 2). The RNA sample that had not been reverse-transcribed did not yield PCR products (Figure 3C, lane 1), confirming the absence of extraneous cDNA or PCR products contaminating the samples.
RAGE Mediation of the Binding of AGE-2m to Synovial Fibroblasts
In view of the presence of RAGE on the surface of human synovial fibroblasts, we considered whether they could mediate interactions with extracellular AGE. Incubation of 125I-AGE-2m with synovial fibroblasts resulted in dose-dependent, specific binding with a Kd of 138.0 ± 0.16 nM (Figure 4A), which is lower than the binding affinity observed previously for skin fibroblasts (27). The radioligand binding was inhibited in the presence of excess amounts of unlabeled AGE-2m but not unmodified 2m. The hypothesis that RAGE are involved in the interaction of AGE-2m with synovial fibroblasts was supported by preincubation studies using anti-RAGE IgG. Anti-RAGE IgG, but not nonimmune IgG, largely inhibited the binding of 125I-AGE-2m to synovial fibroblasts, in a dose-dependent manner (P < 0.001) (Figure 4B).
|
2m, synovial fibroblasts were incubated with 50 µg/ml 125I-AGE-2m for 22 h. The mean amount of degraded radiolabeled ligand demonstrated as TCA-soluble material was 4.8 ± 1.1 ng/µg cell protein (n = 3). 125I-AGE-2m degradation by synovial fibroblasts was reduced to 1.4 ± 0.3 ng/µg cell protein (n = 3) when excess unlabeled ligand was added (P < 0.01, compared with the absence of excess unlabeled ligand) and to 2.1 ± 0.5 ng/µg cell protein (n = 3) when cells were preincubated with 50 µg/ml anti-RAGE before the addition of radiolabeled ligand (P < 0.02, compared with the nonpreincubation group). These results suggest that the degradation of AGE-2m by synovial fibroblasts was partially receptor-dependent and was mediated through RAGE.
AGE-2m Induction of MCP-1 Expression by Synovial Fibroblasts
MCP-1 is a well characterized chemokine that selectively attracts and activates monocytes. We examined the effect of AGE-2m on synovial fibroblast secretion of MCP-1 (25). Synovial fibroblasts were incubated for 48 h with AGE-2m, and the levels of MCP-1 in the supernatants were measured by ELISA. As presented in Figure 5A, a dose-dependent increase in MCP-1 levels (P < 0.001) was observed in the medium from cells incubated with AGE-2m. In contrast, trace concentrations of MCP-1 were detected in the culture medium from cells incubated with unmodified 2m or medium alone. AGE-modified HSA, but not unmodified HSA, also induced MCP-1 production. There was no significant difference in MCP-1 levels in supernatants of cells treated with AGE-2m versus AGE-HSA (P > 0.05). AGE-2m-induced MCP-1 secretion was time-dependent and peaked at 48 h (Figure 5B).
|
2m-induced increase in MCP-1 protein release was associated with an increase in mRNA, Northern blot analysis was performed with isolated human synovial fibroblasts. The results indicated that AGE-2m and AGE-HSA increased the expression of MCP-1 mRNA, compared with their unmodified forms (Figure 6).
|
2m with Blocking of RAGE2m with synovial fibroblasts, adherent synovial fibroblasts were preincubated with 50 µg/ml rabbit anti-human RAGE or nonimmune rabbit IgG for 2 h. This concentration of anti-human RAGE was previously demonstrated to block other effects of AGE-2m in vitro (13). The synovial fibroblasts were then cultured for 48 h with 50 µg/ml AGE-2m. The antibody that blocks the interaction of AGE-2m and RAGE in other systems (13,18,28) significantly diminished the capacity of AGE-2m to induce MCP-1 production (Figure 7). The blocking effect of anti-RAGE was specific; nonimmune IgG had no effect on MCP-1 synthesis.
|
2m was adequate to induce monocyte chemotaxis in vitro. An amount of MCP-1 equivalent to that produced by 105 synovial fibroblasts after stimulation with 50 µg/ml AGE-2m was added to the chamber. This amount of MCP-1 (4.4 ng/ml) induced monocyte chemotaxis (46 ± 6 cells/high-power field, n = 3), in comparison with negative controls with medium alone (10 ± 2 cells/high-power field, n = 3; P < 0.001). The formylmethionylleucylphenylalanine positive controls induced an equivalent amount of chemotaxis (38 ± 5 cells/high-power field, n = 3; P > 0.05, compared with MCP-1).
Increased Expression of MCP-1 on DRA Synovium
Double-labeling immunostaining for RAGE and MCP-1 and for vimentin and MCP-1 was performed for all DRA and control specimens. A majority of the cells that expressed RAGE in DRA also stained positively for MCP-1 (Figure 8, A and B). MCP-1 staining was present on vimentin-positive cells in DRA specimens (Figure 8, C and D) but not in samples from healthy control subjects (Figure 8E).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2m is observed in the amyloid fibrils in DRA and has been suggested to be a provocative agent in this condition (9,21). AGE-modified macromolecules are subject to endocytosis by AGE-specific receptors present in a variety of cell systems, especially monocytes/macrophages, which are thought to facilitate AGE removal and elimination (18,23,28). In addition to serving in the scavenging of senescent macromolecules, cellular interactions with AGE have been demonstrated to promote tissue damage via pathways involving chemical crosslinking and proinflammatory reactions (11,13,18). Such interactions may occur in normal aging and in diseases such as diabetes mellitus and Alzheimer’s disease. Although links between the AGE-laden amyloid deposits and the synovial infiltration of monocytes in DRA have been reported (28), the biologic effects of AGE in human articular structures and their role in DRA-associated tissue damage have not been fully elucidated. As suggested by previous evidence of time-dependent AGE formation in synovial constituents such as collagen (29) and of AGE deposition in amyloid synovium, an AGE-specific cellular pathway may be important in both normal homeostasis and the pathogenesis of joint damage in DRA. As indicated by immunohistochemical analysis of synovial sections from healthy adult subjects, RAGE were expressed constitutively and distributed on synovial fibroblasts. For further identification of the cell type that expresses RAGE, human synovial fibroblasts (the most abundant cells in the synovial intima) were isolated and cultured in vitro. The presence of RAGE on human synovial fibroblasts was confirmed by using specific immunologic and molecular probes corresponding to previously characterized RAGE (30). Binding to other resident cell types in the synovium is currently unknown.
Several AGE-binding molecules have been identified, such as P60, P90 (31), galectin-3 (19), the macrophage scavenger receptor (32), and RAGE. The most well characterized of these is RAGE, a member of the Ig superfamily that is expressed by mononuclear phagocytes, endothelial cells, and smooth muscle cells (33), as well as certain neurons and other cells. RAGE has been demonstrated to mediate the interactions of AGE-modified proteins with endothelium, being responsible for the initial rapid phase of clearance observed after the infusion of AGE-albumin and the induction of interleukin-6 transcripts (34). This receptor may also have a central role in AGE-induced perturbations of mononuclear phagocytes, including enhanced chemotaxis and release of proinflammatory cytokines (28). In the context of the biologic processes of skin fibroblasts, RAGE binds AGE, which is accompanied by changes in collagen synthesis (13). Reported herein is the first study examining the functional pathway of RAGE on human synovial fibroblasts. Our data suggested that AGE-modified 2m, which accumulates in the joints of patients with DRA, interacted with RAGE on the surface of synovial fibroblasts. AGE-2m bound to synovial fibroblasts in a specific, dose-dependent manner, and that process was largely inhibited in the presence of RAGE blockade. The incomplete blockade by anti-RAGE may be a consequence of receptor recycling or the involvement of AGE-binding proteins other than RAGE. The RAGE-mediated endocytosis and degradation of AGE-2m by synovial fibroblasts suggest that fibroblasts might be capable of modulating AGE-modified molecules in vivo.
MCP-1 is a well characterized member of the family of CC chemokines (35) that has been demonstrated to be one of the most potent monocyte chemoattractants and activators. MCP-1 is produced by a wide variety of cell types after stimulation with proinflammatory cytokines or even direct stimulation with whole bacteria (36). Therefore, it may be an important mediator in the regulation of monocyte influx into areas of inflammation. The interaction of synovial fibroblasts with AGE-2m induced marked increases in MCP-1 mRNA expression and protein release. This response was elicited by AGE modification of the protein and was not a property specific to 2m. Other AGE-modified proteins, such as AGE-HSA, also induced MCP-1 synthesis, but unmodified 2m or HSA did not. The capacity of AGE-2m to induce MCP-1 synthesis was significantly decreased by an antibody that blocks the interaction of AGE-proteins and RAGE both in vitro and in vivo (28,37), indicating that this increase in MCP-1 expression was partially mediated by RAGE. DRA is a chronic inflammatory process involving articular structures. A major factor contributing to the development and progression of joint damage is the infiltration of monocytes (5,21). AGE-modified 2m has been speculated to be a potential causative agent in this cellular inflammatory response (21,38). Previous studies demonstrated that AGE-2m induces monocyte chemotaxis (28), delays monocyte apoptosis (38), and transforms monocytes to a macrophage-like morphologic phenotype (38). Therefore, it has been speculated that AGE-2m may contribute to the accumulation of monocytes/macrophages in DRA synovium. This study illustrates an alternative mechanism of AGE-2m-induced monocyte recruitment, i.e., through the release of a synoviocyte-derived chemokine. Because the amount of MCP-1 production stimulated by AGE-2m was sufficient to induce monocyte chemotaxis in vitro, we posit that synovial fibroblasts can actively contribute to an inflammatory response via cellular interactions with AGE-2m. This hypothesis was supported by the immunohistochemical analyses, in which increased expression of MCP-1 was observed on synovial fibroblasts and cells expressing RAGE in DRA synovium. MCP-1 expression on synoviocytes has also been demonstrated in other studies (39,40).
We confirmed the upregulation of RAGE in synovial intimal and subintimal cells of long-term hemodialysis patients with DRA. Consistent with this observation, previous studies demonstrated enhanced RAGE expression by mononuclear phagocytes around cutaneous 2m amyloid deposits (28). RAGE is also expressed at high levels in diabetic vasculature (41), in which AGE are abundant. Although the factors that regulate RAGE expression in these situations remain to be elucidated, these findings indicate that RAGE may be a central binding site for AGE formed in vivo, and they suggest that AGE-2m-RAGE-synoviocyte interactions might be involved in the chronic inflammatory processes observed in DRA.
In summary, our study demonstrates the functional RAGE pathway on human synovial fibroblasts, which mediates the binding and degradation of AGE-proteins as well as the induction of MCP-1 by these cells. Through this pathway, synovial fibroblasts may be actively involved in the cellular inflammatory reactions associated with eventual joint damage and destruction in DRA.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-Microglobulin amyloidosis. Amyloid Int J Exp Clin Invest 4: 187–211, 1997
2-microglobulin. Biochem Biophys Res Commun 129: 701–706, 1985[CrossRef][Medline]
2-microglobulin amyloid deposition in the vertebral column. Kidney Int 41: 1646–1652, 1992[Medline]
2-microglobulin as a new form of amyloid protein in patients undergoing long-term hemodialysis [Letter]. N Engl J Med 314: 585–586, 1986[Medline]
2-Microglobulin modified with advanced glycation end products is a major component of hemodialysis-associated amyloidosis. J Clin Invest 92: 1243–1252, 1993
2-Microglobulin modified with advanced glycation end products modulates collagen synthesis by human fibroblasts. Kidney Int 53: 1365–1373, 1998[CrossRef][Medline]
2-Microglobulin induces MMP-1 but not TIMP-1 expression in human synovial fibroblasts. Kidney Int 57: 2023–2034, 2000[CrossRef][Medline]
2-microglobulin modified with advanced glycation end products in the pathogenesis of hemodialysis-associated amyloidosis. J Clin Invest 93: 521–528, 1994
2-microglobulin and advanced glycation end products in the development of dialysis-related amyloidosis. Kidney Int 51: 1514–1519, 1997[Medline]
2-microglobulin with human mononuclear phagocytes via an oxidant-sensitive pathway. J Clin Invest 98: 1088–1094, 1996[Medline]
2-Microglobulin modified with advanced glycation end products delays monocyte apoptosis. Kidney Int 59: 990–1002, 2001[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  H. Zhang, S. Tasaka, Y. Shiraishi, K. Fukunaga, W. Yamada, H. Seki, Y. Ogawa, K. Miyamoto, Y. Nakano, N. Hasegawa, et al. Role of Soluble Receptor for Advanced Glycation End Products on Endotoxin-induced Lung Injury Am. J. Respir. Crit. Care Med., August 15, 2008; 178(4): 356 - 362. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Pullerits, M. Bokarewa, L. Dahlberg, and A. Tarkowski Synovial fluid expression of autoantibodies specific for RAGE relates to less erosive course of rheumatoid arthritis Rheumatology, August 1, 2007; 46(8): 1367 - 1371. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Rouhiainen, S. Tumova, L. Valmu, N. Kalkkinen, and H. Rauvala Analysis of proinflammatory activity of highly purified eukaryotic recombinant HMGB1 (amphoterin) J. Leukoc. Biol., January 1, 2007; 81(1): 49 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Feng, C. Matsumoto, A. Schwartz, A. M. Schmidt, D. M. Stern, and J. Pile-Spellman Chronic Vascular Inflammation in Patients With Type 2 Diabetes: Endothelial biopsy and RT-PCR analysis Diabetes Care, February 1, 2005; 28(2): 379 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Howes, Y. Liu, J. L. Dunaief, A. Milam, J. M. Frederick, A. Marks, and W. Baehr Receptor for Advanced Glycation End Products and Age-Related Macular Degeneration Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3713 - 3720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. F. Hou, H. Ren, W. F. Owen Jr, Z. J. Guo, P. Y. Chen, A. M. Schmidt, T. Miyata, and X. Zhang Enhanced Expression of Receptor for Advanced Glycation End Products in Chronic Kidney Disease J. Am. Soc. Nephrol., July 1, 2004; 15(7): 1889 - 1896. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
25% of the total binding in all cases. Data were analyzed with a nonlinear least-squares method. Parameters of binding for immobilized synovial fibroblasts included a Kd of 138.0 ± 0.16 nM. (Inset) Scatchard plot analysis. (B) Synovial fibroblasts were preincubated with the indicated concentration of anti-RAGE IgG or nonimmune rabbit IgG for 2 h at 4°C; 125I-AGE-
-RAGE IgG, P < 0.001. The 
