2007 JASN IMPACT FACTOR 7.111	HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP
advanced	CURRENT ISSUE	ARCHIVES	JASN Express	ONLINE SUBMISSION

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Eremina, V. Articles by Quaggin, S. E. Search for Related Content PubMed PubMed Citation Articles by Eremina, V. Articles by Quaggin, S. E.

Glomerular-Specific Gene Excision In Vivo

Vera Eremina^*, Mark Andrew Wong^*, Shiying Cui^*, Lois Schwartz^* and Susan E. Quaggin^*

*The Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, Toronto, Ontario, Canada; and Division of Nephrology, St. Michael’s Hospital, Toronto, Ontario, Canada.

Correspondence to: Susan E. Quaggin, The Samuel Lunenfeld Research Institute, Mt. Sinai Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5. Phone: 416-586-4800; Fax: 416-586-8588; Email: quaggin{at}mshri.on.ca

Abstract

ABSTRACT. Podocytes (glomerular visceral epithelial cells) are highly specialized cells that are found in the renal glomerulus and make up a major portion of the filtration barrier between the blood and urinary spaces. Recently, the identification of a number of genes responsible for both autosomal dominant and recessive forms of human nephrotic syndrome has provided insight into a number of molecules responsible for unique features of the podocyte such as the slit diaphragms. Despite these major advances in our understanding of podocyte biology, the function of many genes expressed in the podocyte remains unknown. Targeted gene disruption using homologous recombination in murine embryonic stem cells (ES cells) is a powerful tool to determine the biologic function of genes in vivo. However, resulting embryonic lethal or pleiotropic phenotypes often preclude the analysis of genes in specific renal cell types. To overcome this problem, a glomerular-specific Cre-recombinase transgenic murine line under the control of the Nphs1 (nephrin) promoter (Neph-Cre) was generated. This article reports successful Cre-mediated excision of a ‘floxed’ transgene specifically in podocytes in vivo. This murine founder line represents a powerful new tool for the manipulation of the expression of genes in podocytes and will provide valuable insight into podocyte biology in the whole animal.

Podocytes are highly specialized cells that are fundamental for glomerular filtration (1). Although water and small molecules pass freely through this filter, critical proteins, such as albumin and blood clotting factors, must not. In addition, podocytes are believed to play a pivotal role in the progression of chronic renal dysfunction due to a variety of causes such as diabetes, aging, and inflammation (2–4).

Despite the importance of the podocyte for development and function of the kidney, little is known about its biology due to the lack of appropriate model systems. Although it has been possible to isolate podocyte cell lines, these cells tend to dedifferentiate in culture. Furthermore, a model system that enables manipulation of gene expression specifically in podocytes in vivo would be valuable.

Recently, we and others have identified and characterized the first glomerular and podocyte-specific promoter from the human and murine nephrin (NPHS1, Nphs1) genes (5,6). NPHS1 encodes a member of the Ig superfamily and is the gene responsible for congenital Finnish nephropathy (7). 1.25 kb of the proximal region of the human NPHS1 promoter and 5.4 kb of the proximal region of the murine promoter are capable of directing transgene expression to the podocyte (5,6). In this article, we also demonstrate that 4.125 kb of the 5' flanking region of murine Nphs1 is capable of directing podocyte-specific expression.

In an attempt to generate murine founder lines that express Cre recombinase specifically in podocytes, 22 independent founder lines with integration of the nephrin-Cre transgene (12 human and 10 murine promoter lines) were produced. To determine if any of these founder lines were capable of podocyte-specific Cre-mediated excision in vivo, they were bred with the Z/EG double reporter mouse line (8). Upon Cre-mediated excision of a ß-geo cassette, these mice express enhanced green fluorescent protein. Green fluorescence podocytes were observed in the offspring of two of these founder lines (mNeph-Cre PC1 and PC2), which were doubly heterozygous for both transgenes and demonstrate successful podocyte-specific Cre-mediated excision in vivo.

Materials and Methods

Generation of Murine-Nephrin Transgenic Lines
A 4.125-kb fragment of the murine promoter (4145 to 8270 bp of accession number AF296764) was amplified from murine genomic DNA by PCR using the following primers: 5'NephPacI 5'CCTTAATTAAGGGGCGCGGGT3' and 3'NephXhoI 5'CCGCTCGAGATTCCCTGAGCCTCTCT3'. The predicted initiation codon begins at bp 8296. A PacI and a XhoI site were added to the 5' and 3' ends during the PCR. This 4.125-kb fragment was isolated on a 1% agarose gel, gel-purified by using the Bio101 Geneclean kit (Qbiogene, Carlsbad, CA), and ligated to the PacI and XhoI sites of the pKO (knockout) vector (kind gift of J. Rossant, The Samuel Lunenfeld Research Institute, Toronto, Canada). The SalI fragment from the pSDK-lacZ cassette, which contains a Kozak consensus sequence and a cytoplasmic ß-galactosidase gene (9) (Figure 1A) was ligated to the XhoI site of the pNeph-KO vector. The sequence for the SDK oligonucleotide is 5'GGAGGCCACCATGGCTCGCGATATCGGTCGAC3'. The final construct was digested with PacI and PmeI and the 9.8-kb fragment was injected into 1-cell mouse embryos as described elsewhere (10). Kidneys from postnatal day 0 mice were fixed in 4% paraformaldehyde and 1.5% glutaraldehyde and stained for ß-galactosidase activity as previously described (11).

View larger version (23K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. Transgenic constructs. 4.125-kb of the 5' flanking and proximal region of the murine NPHS1 gene excluding the predicted initiation codon was amplified, and PacI and XhoI sites were added to the 5' and 3' ends, respectively. This fragment was inserted into the pKO vector (not shown). (A) The SDK-lacZ reporter gene, which contains a Kozak consensus sequence and an initiation ATG, was inserted downstream of the nephrin promoter as a SalI fragment. (B) The NLS-Cre cassette was inserted as a XhoI/KpnI fragment into the NPHS1/pKO construct. SDK, Shine-Dalgarno sequence and Kozak consensus sequence; 5'LacZ, encodes the amino-terminal 146 amino acids of the ß-galactosidase gene; 3'LacZ, encodes the carboxy-terminal region of the ß-galactosidase gene; MC1 TK, herpes simplex thymidine kinase gene; PA, polyadenylation signal.

The human Neph-Cre transgene was constructed by using the Neph-lacZ plasmid described elsewhere (5). The ß-galactosidase cassette was excised by using EcoRI, and an EcoRI fragment containing the NLS-Cre cassette was digested from the NLS-Cre plasmid described above and ligated to the 1.125-kb human nephrin promoter. This transgene was linearized with AflIII and injected into 1-cell murine embryos as described above.

Genotypic Analysis of Transgenic Mice
Genomic DNA was isolated from tails of transgenic mice and used for genotypic analysis as described elsewhere (9). To detect the presence of the lacZ transgene in murine nephrin SDKlacZ mice, genomic DNA was digested with EcoRI and Southern blot analysis was performed using a probe for the ß-galactosidase gene. The Cre transgene was detected by PCR using the following primers: Cre5' 5'ATGTCCAATTTACTGACCG3' and Cre3' 5'CGCCGCATAACCAGTGAAAC3', which amplified a band of approximately 300 bp (Figure 2A). Conditions for the Cre PCR were as follows: a hot start at 95°C for 1 min followed by 35 cycles, which included 30 s at 92°C, 30 s at 50°C, and 40 s at 72°C. Each reaction mix contained 50 µl total volume with 1 µl of purified genomic DNA, 10 mM each dNTP, l µl of each primer (10 µM concentration each), 5 µl of 10X buffer #1 (Boehringer Mannheim Expand Long System; Boehringer Mannheim, Indianapolis, Indiana), and 1 µl of Expand Long. To detect the GFP transgene, DNA was digested with EcoRI and Southern blot analysis was performed as described (9) using a 720-bp GFP probe (Figure 2B). To determine if the transgene had inserted in a single or multiple integration sites, the DNA was also digested with XbaI and Southern blot analysis was performed using a Cre recombinase probe.

View larger version (26K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. Scheme for detection of Cre-mediated excision in vivo. One of the nephrin-Cre founder lines, PC1, was crossed to the Z/EG reporter murine strain. In vivo excision of the floxed ß-geo cassette allows transcription of the enhanced green fluorescent protein gene and should produce green fluorescent podocytes specifically. In other tissues, lack of Cre recombinase activity leaves the Z/EG transgene intact and the absence of fluorescence. Pro-Cre, Neph-Cre transgene; black arrowheads, loxP sites.

View larger version (42K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. Genotypic analysis of the Neph-Cre PC1 X Z/EG offspring. (A) PCR analysis of Cre expression. Offspring 2 and 4 from the Neph-Cre founder line PC1 were positive for the Cre transgene. The PCR primers amplified a Cre fragment, which measures approximately 300 bp. (B) Southern blot analysis of green fluorescent protein (GFP) presence. Genomic DNA was digested with EcoRI and hybridized with a 720-bp GFP probe. Offspring 1 and 4 were positive for the GFP transgene. The EcoRI fragment measures approximately 8 kb.

Results

The 4.125-kb Murine Nephrin Promoter Directs Expression Specifically to Podocytes
Four Neph-SDK-lacZ founder lines were identified by Southern blot analysis. All of these founder lines expressed the ß-galactosidase transgene in glomeruli (Figure 4A) and specifically in podocytes (data not shown). These results are similar to results by Moeller et al. (6), although we used a smaller genomic promoter fragment.

View larger version (90K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 4. Transgenic expression under control of the 4.125-kb murine NPHS1 promoter. (A) The 4.125-kb murine NPHS1 promoter directs expression of the lacZ gene specifically to glomeruli in transgenic mouse kidneys. All founder lines (4 of 4) expressed the transgene in glomeruli. No ectopic expression was observed. (B) A wholemount photomicrograph of a mouse kidney at postnatal day 2 demonstrates GFP expression specifically in glomeruli. This kidney was taken from a mouse doubly heterozygous for the nephrin-Cre and pCaggs-lacZ-GFP transgenes. All fluorescence was detected using FITC optics and a 488-nm filter. GFP is expressed in all glomeruli and demonstrates that the nephrin-Cre recombinase is capable of excising DNA in vivo. (C) 30-µm cryosections were immunostained with an antibody directed against EGFP and demonstrate that the nephrin-Cre recombinase is capable of excising DNA in vivo in podocytes in a late capillary-loop stage glomerulus. (D) Every podocyte stains in a mature glomerulus. In contrast, parietal epithelial cells, mesangial cells, and tubular epithelial cells do not express the Cre-recombinase or EGFP. po, podocyte; pa, parietal epithelial cell; me, mesangial cell, tu, tubular epithelial cell.

Furthermore, cryosections demonstrated fluorescence consistent with podocyte-specific expression from the capillary loop stage of glomerulogenesis onwards (Figure 4C). To determine the number of glomeruli and podocytes that are fluorescing, we performed immunohistochemical analysis using an antibody that detects EGFP. These results demonstrated that all of the glomeruli undergo site-specific recombination. Similarly, within each glomerulus, the diffuse staining pattern demonstrated that the Cre recombinase was active in every podocyte (Figure 4D). Wholemount and cryosection analysis of other tissues demonstrated Cre activity in the rhombic lip but not in the pancreas of these bitransgenic mice, two tissues, which also express nephrin mRNA.

None (0 out of 12) of the human Neph-Cre founder lines demonstrated Cre-mediated excision in vivo. To date, only 4 out of 10 murine founder lines have been crossed with the Z/EG reporter strain. Analysis of the remaining 6 lines is ongoing.

Discussion

Podocytes make up a major portion of the filtration barrier between the blood and urinary spaces (1). Elegant studies by Reeves et al. (13,14) and Abrahamson et al. (15–17) have provided fundamental knowledge about the unique structure and function of the podocyte and the glomerular filtration barrier. In addition, careful morphologic studies performed by Kriz et al. (18,19) suggest that podocytes play a pivotal role in the progression of glomerulosclerosis in a variety of renal diseases. More recently, the identification of a number of genes that cause inherited glomerular disease in humans and studies of knockout mice have provided a molecular foothold into podocyte biology (7,20–23).

Despite these advances, the role of many genes, which are thought to be important for podocyte function, are still unknown. The ability to disrupt gene function in specific cell types using the Cre-loxP system has been invaluable in studying the role of a number of genes in the heart, germline, and central nervous system. Cre recombinase is a bacteriophage enzyme that causes site-specific recombination between loxP sites (24). We and others have identified the promoter region from the murine NPHS1 gene that is capable of driving the expression of transgenes specifically in podocytes from the capillary loop stage of development onwards. We used 4.125 kb of the murine NPHS1 promoter to drive expression of a nuclear-localized Cre recombinase specifically to podocytes in the kidney. In this article, we demonstrate that two of these founder lines are capable of excising DNA surrounded by loxP sites in podocytes in vivo. Although we have not bred this line to homozygosity, it excises DNA in every podocyte within the transgenic kidney. One of the four lines tested to date did not demonstrate excision in vivo, and a second line has not provided any bitransgenic offspring to study. It follows that transcriptional activity of the 4.125-kb promoter to drive adequate levels of Cre recombinase for in vivo excision is influenced by the chromosomal integration site. Furthermore, none of the human nephrin founders were capable of excising DNA in vivo, and this is likely the result of too low a level of transcriptional activity. The excising founder lines will be a useful resource to disrupt the expression of a variety of genes in the podocyte to unravel the biology of this fascinating cell type.

We also performed an analysis to determine activity of Cre recombinase in other tissues of the mouse and found fluorescence in the rhombic lip of the developing brain but no expression in the pancreas. In-depth molecular marker studies of the neural cells that express Cre-recombinase in these animals are in progress. Investigators who wish to use these murine lines to manipulate gene expression in the podocyte will also need to determine if their gene of interest is expressed in this small subset of specialized neurons.

Finally, the production of inducible versions of podocyte-specific Cre-recombinase murine lines will enable the temporal as well as spatial manipulation of genes and will be particularly useful in understanding the role of genes in acquired diseases of the podocyte.

Acknowledgments

We thank Dr. Andras Nagy for providing the Z/EG reporter mice and valuable experimental advice, Sabine Cordes for helpful discussions regarding the neural expression patterns, Johanne Pellerin for outstanding technical assistance, and Dragana Vukasovic for expert secretarial assistance. Dr. S. E. Quaggin is a Canada Research Chair Tier II Recipient, a CIHR Clinician-Scientist Phase II Awardee, and Canadian Foundation for Innovation New Opportunities Researcher. This work was funded by NIH Grant #59148–02 to S. E. Quaggin.

References

1. Mundel P, Kriz W: Structure and function of podocytes: An update. Anat Embryol (Berl) 192: 385–397, 1995[Medline]
2. Abrass CK: The nature of chronic progressive nephropathy in aging rats. Adv Ren Replace Ther 7: 4–10, 2000[Medline]
3. Kriz W, Lemley K: The role of the podocyte in glomerulosclerosis. Curr Opin Nephrol Hypertens 8: 489–497, 1999[CrossRef][Medline]
4. Pagtalunan ME, Miller PL, Jumping-Eagle S, Nelson RG, Myers BD, Rennke HG, Coplon NS, Sun L, Meyer TW: Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest 99: 342–348, 1997[Medline]
5. Wong MA, Cui S, Quaggin SE: Identification and characterization of a glomerular-specific promoter from the human nephrin gene. Am J Physiol Renal Physiol 279: F1027–F1032, 2000[Abstract/Free Full Text]
6. Moeller MJ, Kovari IA, Holzman LB: Evaluation of a new tool for exploring podocyte biology: Mouse Nphs1 5' flanking region drives LacZ expression in podocytes. J Am Soc Nephrol 11: 2306–2314, 2000[Abstract/Free Full Text]
7. Kestila M, Lenkkeri U, Mannikko M, Lamerdin J, McCready P, Putaala H, Ruotsalainen V, Morita T, Nissinen M, Herva R, Kashtan CE, Peltonen L, Holmberg C, Olsen A, Tryggvason K: Positionally cloned gene for a novel glomerular protein–nephrin–is mutated in congenital nephrotic syndrome. Mol Cell 1: 575–582, 1998[CrossRef][Medline]
8. Novak A, Guo C, Yang W, Nagy A, Lobe CG: Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision. Genesis 28: 147–155, 2000[CrossRef][Medline]
9. Puri MC, Rossant J, Alitalo K, Bernstein A, Partanen J: The receptor tyrosine kinase TIE is required for integrity and survival of vascular endothelial cells. Embo J 14: 5884–5891, 1995[Medline]
10. Joyner AL: Gene Targeting: A Practical Approach. New York, Oxford University Press, 2000
11. Partanen J, Puri MC, Schwartz L, Fischer KD, Bernstein A, Rossant J: Cell autonomous functions of the receptor tyrosine kinase TIE in a late phase of angiogenic capillary growth and endothelial cell survival during murine development. Development 122: 3013–3021, 1996[Abstract]
12. Quaggin SE, Schwartz L, Post M, Rossant J: The basic-helix-loop-helix protein Pod-1 is critically important for kidney and lung development. Development 126: 5771–5783, 1999[Abstract]
13. Reeves W, Caulfield JP, Farquhar MG: Differentiation of epithelial foot processes and filtration slits: Sequential appearance of occluding junctions, epithelial polyanion, and slit membranes in developing glomeruli. Lab Invest 39: 90–100, 1978[Medline]
14. Reeves WH, Kanwar YS, Farquhar MG: Assembly of the glomerular filtration surface. Differentiation of anionic sites in glomerular capillaries of newborn rat kidney. J Cell Biol 85: 735–753, 1980[Abstract/Free Full Text]
15. Abrahamson DR: Glomerulogenesis in the developing kidney. Semin Nephrol 11: 375–389, 1991[Medline]
16. Robert B, Zhao X, Abrahamson DR: Coexpression of neuropilin-1, flk1, and VEGF(164) in developing and mature mouse kidney glomeruli. Am J Physiol Renal Physiol 279: F275–F282, 2000[Abstract/Free Full Text]
17. Robert B, St. John PL, Hyink DP, Abrahamson DR: Evidence that embryonic kidney cells expressing flk-1 are intrinsic, vasculogenic angioblasts. Am J Physiol 271: F744–F753, 1996[Abstract/Free Full Text]
18. Kriz W, Elger M, Nagata M, Kretzler M, Uiker S, Koeppen-Hagemann I, Tenschert S, Lemley KV: The role of podocytes in the development of glomerular sclerosis. Kidney Int 45: S64–S72, 1994
19. Kriz W, Kretzler M, Nagata M, Provoost AP, Shirato I, Uiker S, Sakai T, Lemley KV: A frequent pathway to glomerulosclerosis: deterioration of tuft architecture-podocyte damage-segmental sclerosis. Kidney Blood Press Res 19: 245–253, 1996[Medline]
20. Kaplan JM, Kim SH, North KN, Rennke H, Correia LA, Tong HQ, Mathis BJ, Rodriguez-Perez JC, Allen PG, Beggs AH, Pollak MR: Mutations in ACTN4, encoding alpha-actinin-4, cause familial focal segmental glomerulosclerosis. Nat Genet 24: 251–256, 2000[CrossRef][Medline]
21. Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, Dahan K, Gubler MC, Niaudet P, Antignac C: NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome: Nat Genet 24: 349–354, 2000[CrossRef][Medline]
22. Shih NY, Li J, Karpitskii V, Nguyen A, Dustin ML, Kanagawa O, Miner JH, Shaw AS: Congenital nephrotic syndrome in mice lacking CD2-associated protein. Science 286: 312–315, 1999[Abstract/Free Full Text]
23. Noakes PG, Miner JH, Gautam M, Cunningham JM, Sanes JR, Merlie JP: The renal glomerulus of mice lacking s-laminin/laminin beta 2: Nephrosis despite molecular compensation by laminin beta 1. Nat Genet 10: 400–406, 1995[CrossRef][Medline]
24. Rossant J, Nagy A: Genome engineering: The new mouse genetics. Nat Med 1: 592–594, 1995[CrossRef][Medline]

This article has been cited by other articles:

				A. M. Waters, M. Y.J. Wu, T. Onay, J. Scutaru, J. Liu, C. G. Lobe, S. E. Quaggin, and T. D. Piscione Ectopic Notch Activation in Developing Podocytes Causes Glomerulosclerosis J. Am. Soc. Nephrol., June 1, 2008; 19(6): 1139 - 1157. [Full Text] [PDF]

				R. L. Miller, P. Zhang, T. Chen, A. Rohrwasser, and R. D. Nelson Automated method for the isolation of collecting ducts Am J Physiol Renal Physiol, July 1, 2006; 291(1): F236 - F245. [Abstract] [Full Text] [PDF]

				J. H. Miner, G. Go, J. Cunningham, B. L. Patton, and G. Jarad Transgenic isolation of skeletal muscle and kidney defects in laminin {beta}2 mutant mice: implications for Pierson syndrome Development, March 1, 2006; 133(5): 967 - 975. [Abstract] [Full Text] [PDF]

				J. Juhila, R. Roozendaal, M. Lassila, S. J. Verbeek, and H. Holthofer Podocyte Cell-Specific Expression of Doxycycline Inducible Cre Recombinase in Mice J. Am. Soc. Nephrol., March 1, 2006; 17(3): 648 - 654. [Abstract] [Full Text] [PDF]

				L. Wang, T. A. Fields, K. Pazmino, Q. Dai, J. L. Burchette, D. N. Howell, T. M. Coffman, and R. F. Spurney Activation of G{alpha}q-Coupled Signaling Pathways in Glomerular Podocytes Promotes Renal Injury J. Am. Soc. Nephrol., December 1, 2005; 16(12): 3611 - 3622. [Abstract] [Full Text] [PDF]

				G. Belteki, J. Haigh, N. Kabacs, K. Haigh, K. Sison, F. Costantini, J. Whitsett, S. E. Quaggin, and A. Nagy Conditional and inducible transgene expression in mice through the combinatorial use of Cre-mediated recombination and tetracycline induction Nucleic Acids Res., March 22, 2005; 33(5): e51 - e51. [Abstract] [Full Text] [PDF]

				G. Guo, D. J. Morrison, J. D. Licht, and S. E. Quaggin WT1 Activates a Glomerular-Specific Enhancer Identified from the Human Nephrin Gene J. Am. Soc. Nephrol., November 1, 2004; 15(11): 2851 - 2856. [Abstract] [Full Text] [PDF]

				A. Gawlik and S. E. Quaggin Deciphering the Renal Code: Advances in Conditional Gene Targeting Physiology, October 1, 2004; 19(5): 245 - 252. [Abstract] [Full Text] [PDF]

				I. Rubera, C. Poujeol, G. Bertin, L. Hasseine, L. Counillon, P. Poujeol, and M. Tauc Specific Cre/Lox Recombination in the Mouse Proximal Tubule J. Am. Soc. Nephrol., August 1, 2004; 15(8): 2050 - 2056. [Abstract] [Full Text] [PDF]

				P. Igarashi Kidney-Specific Gene Targeting J. Am. Soc. Nephrol., August 1, 2004; 15(8): 2237 - 2239. [Full Text] [PDF]

				T. Benzing Signaling at the Slit Diaphragm J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1382 - 1391. [Full Text] [PDF]

				S. Hoffmann, D. Podlich, B. Hahnel, W. Kriz, and N. Gretz Angiotensin II Type 1 Receptor Overexpression in Podocytes Induces Glomerulosclerosis in Transgenic Rats J. Am. Soc. Nephrol., June 1, 2004; 15(6): 1475 - 1487. [Abstract] [Full Text] [PDF]

				R. A. Bianco, H. L. Keen, J. L. Lavoie, and C. D. Sigmund Untraditional methods for targeting the kidney in transgenic mice Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1027 - F1033. [Abstract] [Full Text] [PDF]

				P. K. Stricklett, D. Taylor, R. D. Nelson, and D. E. Kohan Thick ascending limb-specific expression of Cre recombinase Am J Physiol Renal Physiol, July 1, 2003; 285(1): F33 - F39. [Abstract] [Full Text] [PDF]

				J.-L. Michaud, L. I. Lemieux, M. Dube, B. C. Vanderhyden, S. J. Robertson, and C. R.J. Kennedy Focal and Segmental Glomerulosclerosis in Mice with Podocyte-Specific Expression of Mutant {alpha}-Actinin-4 J. Am. Soc. Nephrol., May 1, 2003; 14(5): 1200 - 1211. [Abstract] [Full Text] [PDF]

				L. Bugeon, A. Danou, D. Carpentier, P. Langridge, N. Syed, and M. J. Dallman Inducible Gene Silencing in Podocytes: A New Tool for Studying Glomerular Function J. Am. Soc. Nephrol., March 1, 2003; 14(3): 786 - 791. [Abstract] [Full Text] [PDF]

				J. A. Kreidberg Podocyte Differentiation and Glomerulogenesis J. Am. Soc. Nephrol., March 1, 2003; 14(3): 806 - 814. [Full Text] [PDF]

				O. Beltcheva, S. Kontusaari, S. Fetissov, H. Putaala, P. Kilpelainen, T. Hokfelt, and K. Tryggvason Alternatively Used Promoters and Distinct Elements Direct Tissue-Specific Expression of Nephrin J. Am. Soc. Nephrol., February 1, 2003; 14(2): 352 - 358. [Abstract] [Full Text] [PDF]

				H. Pavenstadt, W. Kriz, and M. Kretzler Cell Biology of the Glomerular Podocyte Physiol Rev, January 1, 2003; 83(1): 253 - 307. [Abstract] [Full Text] [PDF]

				T. A. Natoli, J. Liu, V. Eremina, K. Hodgens, C. Li, Y. Hamano, P. Mundel, R. Kalluri, J. H. Miner, S. E. Quaggin, et al. A Mutant Form of the Wilms' Tumor Suppressor Gene WT1 Observed in Denys-Drash Syndrome Interferes with Glomerular Capillary Development J. Am. Soc. Nephrol., August 1, 2002; 13(8): 2058 - 2067. [Abstract] [Full Text] [PDF]

				X. Shao, S. Somlo, and P. Igarashi Epithelial-Specific Cre/lox Recombination in the Developing Kidney and Genitourinary Tract J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1837 - 1846. [Abstract] [Full Text] [PDF]

				S. E. Quaggin A "Molecular Toolbox" for the Nephrologist J. Am. Soc. Nephrol., June 1, 2002; 13(6): 1682 - 1685. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Eremina, V. Articles by Quaggin, S. E. Search for Related Content PubMed PubMed Citation Articles by Eremina, V. Articles by Quaggin, S. E.