Abolition of Hypertension-Induced End-Organ Damage by Androgen Receptor Blockade in Transgenic Rats Harboring the Mouse Ren-2 Gene
Ovidiu Baltatu*,
Cécile Cayla*,
Radu Iliescu*,,
Dmitrii Andreev*,,
Cynthia Jordan and
Michael Bader*
*Max-Delbrück-Center for Molecular Medicine (MDC), Berlin-Buch, Germany; Department of Pharmacology at the University of Medicine and Pharmacy "Gr. T. Popa," Iasi, Romania; Medical Faculty of Moscow Medical Sechenov Academy, Moscow, Russia; and University of California, Department of Psychology, Berkeley, California.
Correspondence to Dr. Michael Bader, Max-Delbrück-Center for Molecular Medicine (MDC), Robert-Rössle-Str. 10, Berlin-Buch, D-13092, Germany. Phone: 49-30-9406-2193; Fax: 49-30-9406-2110; E-mail: mbader{at}mdc-berlin.de
ABSTRACT. A sexual dimorphism in hypertension has been observedin both human and laboratory animal studies. The mechanismsby which male sex hormones regulate cardiovascular homeostasisare still not yet fully understood and represent the subjectof this study. The possible involvement of androgen receptorsin the development of hypertension and end-organ damage in transgenicrats harboring the mouse Ren-2 renin gene [TGR(mREN2)27] wasstudied. Male TGR(mREN2)27 rats were treated with the androgenreceptor antagonist Flutamide starting at 4 wk of age. Also,an androgen receptor mutation (testicular feminization mutation[tfm]) was introduced in these rats by crossbreeding male TGR(mREN2)27rats with tfm rats. The resulting offspring male rats that containthe tfm mutation are insensitive to androgens. Flutamide treatmentor tfm mutation produced a significant attenuation of the developmentof hypertension. Besides a reduction in cardiac hypertrophy,urinary albumin excretion was blunted and no histologic characteristicsof end-organ damage were observed in the kidney after Flutamidetreatment. Testosterone levels increased 15-fold after Flutamidetreatment and 2.7-fold by the tfm mutation. Also, plasma estrogensand luteinizing and follicle-stimulating hormones were significantlyincreased. Plasma renin concentrations and activity but notplasma angiotensinogen were reduced. Our results indicate thatandrogens contribute not only to the development of hypertension,but even more importantly to end-organ damage in TGR(mREN2)27rats.
Men are predisposed to hypertension and cardiovascular diseasesmore than age-matched, premenopausal women (1). A sexual dimorphismin hypertension has been observed both in human and laboratoryanimal studies (2). The mechanisms responsible for the genderdifferences in BP control are not yet clear and continue tobe subject of active investigation (3). Evidence is accumulatingthat androgens may play an important role in gender-associateddifferences in BP regulation. Several studies have indicatedthat androgens may mediate hypertension and renal injury (4–8).However, the mechanisms by which male sex hormones regulatecardiovascular homeostasis are not yet fully understood (3)and represent the subject of this study. There are indicationsfor an interrelation between androgens and the renin-angiotensinsystem (RAS) (3); therefore, we studied the consequences ofandrogen receptor blockade on the development of malignant hypertensionin transgenic TGR(mREN2)27 rats with overactive RAS (9,10).Androgen receptor inhibition was achieved by treatment withthe antagonist Flutamide or by introducing a testicular feminizationmutation (tfm) mutation, and BP as well as end-organ damageand RAS and pituitary-gonadal hormones were evaluated.
Rat Strains
Male transgenic heterozygous rats [TGR(mREN2)27] (n = 24 rats)were obtained from the animal facilities of the Max-Delbrück-Centerfor Molecular Medicine, Berlin, Germany. Female Long-Evans ratscarrying the X-linked recessive mutation (tfm) were providedby the Department of Psychology, University of California, Berkely,California. The rats were housed individually, synchronizedto a 12-h light-dark cycle, at ambient temperature 23 ±2°C. A standard rat diet (ssniff R-ZUCHT) and tap waterwere supplied ad libitum.
Study Design
All experimental protocols were performed in accordance withthe guidelines for the human use of laboratory animals by theMax-Delbrück-Center for Molecular Medicine and approvedby an ethical committee.
To study the involvement of androgen receptors in the developmentof hypertension and end-organ damage in male TGR(mREN2)27 rats,two experimental strategies were used:
Treatment with Flutamide(specific nonsteroidal competitiveantagonist of the androgenreceptor, 30 mg/kg per d subcutaneously(11) starting at 4 wkof age (n = 12) before the developmentof hypertension. A groupof 12 rats received subcutaneous injectionssolely of the Flutamidesolvent and represented the referencegroup.
Male TGR(mREN2)27rats were crossbred with female Long-Evanscarrying the X-linkedrecessive mutation in the rat androgenreceptor (tfm). The resultingoffspring male rats that containedthe tfm mutation are insensitiveto androgens. The male littermateslacking the tfm mutationrepresented the control group.
BP development was followed telemetrically, as described previously(12). The rats were implanted at the age of 7 to 8 wk with radiofrequencytransmitters (TA11PA-C40; Data Sciences, St. Paul, MN). Forthe implantation of the transmitter, rats were anesthetizedwith 10 mg/100 g body wt Ketamin (Ketavet Parke-Davis, Berlin,Germany) plus 0.02 mg/100 g body wt xylazine (Rompun; Bayer,Leverkusen, Germany). The catheter of the transducer was implantedinto the abdominal aorta just below the bifurcation of renalarteries, and the sensor itself was fixed to the peritoneum.
At the age of 12 wk, when the hypertension levels became stable,the 24-h urine was collected. The rats were the sacrificed bydecapitation under light ether anesthesia. Plasma was collectedfor hormone analysis. Cardiovascular organs were excised forhistology and gene expression analysis.
Genotyping of the tfm Mutation
The offspring of female Long-Evans rats carrying the tfm mutationin the androgen receptor gene on the X chromosome and transgenicmales harboring the mouse Ren-2 renin gene [TGR(mREN2)27] wasanalyzed to identify animals carrying the mutation. The mutationconsists of a single base change from G in wild-type DNA toA in the tfm DNA in the coding region (13). The presence ofthis mutation erases the recognition site for the restrictionenzyme AvaII (GGTCC). For genotyping, oligonucleotides weredesigned to amplify by PCR a fragment flanking the tfm mutation(forward primer: CTTCCGCAACTTGCATGTGG; reverse primer: TCATTGAAAACCAGGTCAGG).The amplified fragment has a length of 144 bp and is digestedby AvaII in two fragments of 84 and 60 bp only in the case ofthe presence of the wild-type allele. Together with the morphologyof the reproductive organs, this PCR allows to distinguish allpossible genotypes of the rats (Figure 1).
Figure 1. Genotyping of rats. Rats were genotyped by assessment of the morphology of the reproductive organs and a PCR for the androgen receptor gene followed by an AvaII digestion of the product. (A) Predicted AvaII fragments and morphology of reproductive organs for each genotye. (B) Example of PCR result for different genotypes; X174 DNA digested with HaeIII was used a size marker.
Kidney Damage Evaluation
Urine was collected by placing the rats into metabolic cagesfor 24 h. Rat urinary albumin (index of kidney damage) was determinedby Immundiagnostics (Bensheim, Germany) using a specific ELISA.For histologic analysis, kidneys were excised, decapsulated,and fixed with 10% formalin in 0.01 M phosphate-buffered saline(PBS), pH 7.4, and dehydrated by immersing them stepwise intovarious concentrations of ethyl alcohol from low to high. Thetissues were then embedded in paraffin and sectioned into 4-µm-thickslices, and the sections were stained with Goldner trichrome.Cytoplasm, muscle tissue, and erythrocytes are stained in red;collagen is stained in green. At least five randomly selectedareas per sample were observed.
Heart Hypertrophy Evaluation
The hearts were excised, washed in ice-cold saline, blotteddry, and weighed. The left ventricles were separated and weighed.
Hormone Measurements
Plasma was obtained from trunk blood collected on EDTA (6.25mmol/L) after centrifugation at 4000 rpm. On the basis of apublished report (14), plasma renin concentration and activitywere determined using an indirect enzyme-kinetic assay basedon the generation of angiotensin I with modification of thepH optimum to measure rat and mouse plasma renin activity (PRA)and plasma renin concentration (PRC). Angiotensinogen, testosterone,estrogens, and luteinizing and follicle-stimulating hormoneswere measured by RIA.
Gene Expression Studies
Total RNA was isolated from the kidney using the TRIzol Reagent(Life Technologies, Eggenstein, Germany) followed by chloroform-isopropanolextraction, according to the protocol of the manufacturer. SpecificmRNAs for rat or mouse renin were determined by ribonucleaseprotection assay (RPA), using the Ambion RPA II kit (AMS Biotechnology,Witney, UK) as described previously (15). For semiquantitativedetermination of mRNA levels, band intensities were normalizedto the housekeeping gene -actin.
Statistical Analyses
Data were analyzed by independent-samples t test between two-groupcomparisons or by GLM (general linear model)-general factorialor repeated measures procedure (SPSS 8.0) for multi-group andmultifactorial analysis. Criterion for significant differencesbetween groups of study was a P value less than 0.05. Resultsare expressed as the mean ± SEM.
Effect of Flutamide Treatment or tfm Mutation onBody Weight
The body weight was not significantly altered by the Flutamidetreatment (Flutamide: 377.9 ± 5.2 g versus control: 362.4± 18.1 g at the end of experiment). The tfm rats weighedsignificantly less than the wild-type controls (tfm+: 366.6± 6.9 g versus tfm-: 427.0 ± 24.1 g at the endof experiment).
Effect of Flutamide Treatment or tfm Mutation on BP
Untreated TGR(mREN2)27 rats developed fulminant hypertensionstarting at 10 wk of age as measured by telemetry (Figure 2).Flutamide treatment or the presence of the tfm mutation decreasedsignificantly the levels of systolic BP (Figure 2). Furthermore,Flutamide increased the survival rate from approximately 76%at the age of 12 wk to 100%.
Figure 2. Effect of androgen receptor antagonism or insensitivity on the development of hypertension. (A) Untreated TGR(mREN2)27 rats (Control, n = 5) compared with TGR(mREN2)27 rats treated with Flutamide (Flutamide, n = 6). (B) Normal TGR(mREN2)27 tfm-negative (wild-type, n = 7) compared with TGR(mREN2)27 littermates harboring the tfm mutation, (tfm, n = 7). * significantly different (P < 0.05).
Effect of Flutamide Treatment or tfm Mutation on End-Organ Damage
Untreated hypertensive TGR(mREN2)27 rats developed signs ofmalignant hypertension with end-organ damage, including renaland cardiac pathology. The urinary albumin (as index of kidneydamage) was drastically reduced by either Flutamide treatmentor the presence of tfm mutation (Figure 3A). Furthermore, thekidney morphologic signs characteristic for the malignant hypertension(fibrinoid necrosis of arterioles and onion-shaped proliferativelesions) disappeared after Flutamide treatment (Figure 4). TheTGR(mREN2)27 rats carrying the tfm mutation and their controllittermates had normal kidney morphology at light microscopy.However, the urinary albumin, which is a marker that providesevidence of kidney damage before the development of lesionsdetectable by light microscopy (16–18), reached high levelsin the control male littermates lacking the tfm mutation (Figure 3B).The lack of morphologic signs characteristic for the malignanthypertension in the control male littermates lacking the tfmmutation could be due to lower BP levels compared with Flutamidecontrols and/or to the different genetic background of the twostrains [TGR(mREN2)27 rats, having Sprague-Dawley background,crossbred with female Long-Evans carrying the tfm mutation resultsin a mixed Sprague-Dawley-Long-Evans background]. Although cardiacand left ventricular hypertrophies were reduced by both androgenreceptor-targeting strategies, this effect only reached statisticalsignificance after Flutamide treatment (Figure 5).
Figure 3. Effect of androgen receptor antagonism or insensitivity on urinary albumin excretion. (A) Untreated TGR(mREN2)27 rats (Control, n = 8) compared with TGR(mREN2)27 rats treated with Flutamide (Flutamide, n = 6). (B) Normal TGR(mREN2)27 tfm-negative (wild-type, n = 7) compared with TGR(mREN2)27 littermates harboring the tfm mutation, (tfm, n = 7). *** significantly different (P < 0.005).
Figure 4. Abolition of hypertension-induced kidney histopathology by Flutamide treatment. While in the kidney of untreated TGR(mREN2)27 fibrinoid necrosis, concentric wall thickening of arterioles (A and B) and hyperplastic arteriolosclerosis is observed; Flutamide-treated TGR(mREN2)27 exhibit a completely normal histologic aspect of the kidney (C).
Figure 5. Effect of androgen receptor antagonism or insensitivity on heart and left ventricular (LV) hypertrophy. (A) Untreated TGR(mREN2)27 rats (Control, n = 12) compared with TGR(mREN2)27 rats treated with Flutamide (Flutamide, n = 12). (B) Normal TGR(mREN2)27 tfm-negative (wild-type, n = 7) compared with TGR(mREN2)27 littermates harboring the tfm mutation (tfm, n = 7). * significantly different (P < 0.05).
Effect of Flutamide Treatment or tfm Mutation on RAS
Plasma renin concentrations and activities were reduced afterFlutamide treatment or by the presence of the tfm mutation (Table 1).RPA for rat or mouse renin mRNAs in kidney revealed significantlydecreased levels after Flutamide treatment (Table 1). However,the levels of renin mRNAs were not altered significantly bythe presence of the tfm mutation. Plasma angiotensinogen wasalso not altered.
Table 1. Effect of androgen receptor antagonism or insensitivity on plasma renin concentrations (PRC) and activities (PRA), angiotensinogen, and kidney renin mRNA levels
Effect of Flutamide Treatment or tfm Mutation on Pituitary-Gonadal Axis
Testosterone levels increased 15-fold after Flutamide treatmentand 2.7-fold by the tfm mutation (Table 2). Plasma estrogensand luteinizing and follicle-stimulating hormones were significantlyincreased to a similar degree by both Flutamide treatment ortfm mutation (Table 2).
Table 2. Effect of androgen receptor antagonism or insensitivity on plasma levels of testosterone, estrogens, luteinizing (LH), and follicle-stimulating (FSH) hormones
Gender differences have been observed in various hypertensiveanimal models. Male rats have higher BP than females in thespontaneously hypertensive strain (SHR) (8), and the Dahl salt-sensitivestrain (19) in deoxycorticosterone-salt (20,21), and sodium-sensitiverenal-wrap hypertension (22). Moreover, several reports haveindicated a role of androgens and androgen receptors in hypertension(reviewed in reference 3). In the present study, we investigatedthe involvement of androgen receptors in the end-organ damagein TGR(mREN2)27 rats, which represent a model of hypertensionwith a defined genetic cause. They develop fulminant hypertensionat an early age and end-organ damage similarly to human malignantphase hypertension (23). Using a double experimental strategy,we demonstrated that androgen receptors contribute to the developmentof malignant hypertension induced by an overactive RAS. Androgenreceptor blockade by either Flutamide or introduction of a tfmmutation significantly attenuated the development of hypertensionin TGR(mREN2)27. Moreover, kidney damage was significantly attenuatedby the tfm mutation. Notably, Flutamide treatment totally preventedkidney damage, as evidenced by the normal histologic pictureand the absence of albuminuria. Furthermore, a significant decreaseof cardiac and left ventricular hypertrophy was observed onlyafter Flutamide treatment. These observations are particularlyremarkable because the Flutamide treated and the tfm rats stilldevelop equally severe hypertension with systolic BP of 185to 190 mmHg.
It has been shown that renin-angiotensin inhibitors may preventend-organ damage independent of the BP reduction in TGR(mREN)27(24,25). Also, renin gene expression and activity can be regulatedby androgens (26,27). Therefore, the prevention of end-organdamage by Flutamide treatment could be independent of BP levels,possibly due to the inhibiting effect on the RAS. Indeed, inthe present study, both Flutamide and the presence of the tfmmutation reduced plasma renin concentrations and activity butnot plasma angiotensinogen. In Flutamide-treated rats, the kidneymRNA levels for rat and mouse renin were reduced in correlationto lower plasma concentrations and activities. However, reningene expression levels in the kidney were unaffected by thetfm mutation. This may be explained by the presence of a residualandrogen receptor activity in the tfm rats (13). The higherlevels of renin mRNA in the kidney of the tfm rats comparedwith the flutamide-treated animals may elicit a higher RAS activitylocally in the kidney. Local angiotensin generation in the kidney,however, is a major determinant of hypertension-induced damagein this organ (10).
Androgens can promote hypertension in models characterized byhigh salt intake and presumably a suppressed renin/angiotensin/aldosteroneaxis (28) as well as in renin-dependent models (27,29). Thisimplies that mechanisms other than renin-suppression may alsobe involved even in the TGR(mREN2)27 model. Flutamide is a nonsteroidalandrogen receptor antagonist with no agonist activity and isused in the treatment of advanced prostate cancer (30). Itsactive metabolite, 2-hydroxyflutamide, inhibits the uptake and/orbinding of androgens to the androgen receptor (31). Flutamidetreatment induces a feedback increase of testosterone associatedwith a significant augmentation of plasma gonadotropin concentrations(32). Indeed, in our study Flutamide increased plasma testosteronelevels 15-fold. This tremendous increase of testosterone maybe involved in the lowering of BP. Besides its genomic effects,it has been reported that testosterone can induce direct vascularrelaxation (33–35). On the other hand, it has also beenreported that testosterone increases vascular resistance (36)by inducing the release of thromboxane A2 (37).
Males possessing the tfm mutation are entirely androgen-insensitiveand externally appear to be female, despite abdominal testesand normal-to-elevated circulating levels of testosterone (38,39).As after Flutamide treatment, the tfm mutation caused alterationof plasma gonadotropin and sex hormones. However, while LH,FSH, and estrogen levels increased similarly when compared withFlutamide treatment, testosterone levels increased only 2.7-foldby the presence of the tfm mutation. The differences in thesehormone levels after Flutamide treatment and in the rats withthe tfm mutation may also explain the more pronounced beneficialeffects of Flutamide on cardiac hypertrophy and renal damage.However, direct effects of Flutamide independent of its antiandrogenicactions cannot be ruled out for the explanation of this discrepancy.
Flutamide as well as the tfm mutation significantly increasednot only the plasma levels of testosterone but also of estrogens.This effect on estrogens could also represent an antihypertensiveand cardioprotective as well as renoprotective mechanism. Epidemiologicstudies are indicating that estrogen replacement therapy hasa protective effect on the cardiovascular system in postmenopausalwomen (40). The protective action of estrogen is mediated byintracellular receptors and, thus, by alterations of gene expression.In addition to the genomic effect and like testosterone, estrogenscan have a direct vasorelaxing action without altering geneexpression (41). Recently, it has been found that estrogenscan directly activate a membrane potassium ion (Maxi-K) channel,as one mechanism for their rapid modulation of vascular tone(42,43). Estrogen is also known to lower renin levels (44) andto inhibit the sympathetic outflow (45,46), which contributesto its renin downregulation effect (46,47). As TGR(mREN)27 ratshave increased plasma concentration of norepinephrine (25) andflutamide treatment has been shown to decrease catecholaminelevels in SHR (11), sympathetic inhibition may also contributeto the attenuation of hypertension after androgen receptor blockade.
To summarize, the major findings of this study are: (1) androgenreceptors are contributing to the hypertension and end-organdamage caused by an overactive RAS; (2) androgen receptor blockadeinhibits renin expression and activity; (3) pituitary-gonadalhormone levels are increased by both Flutamide treatment ortfm mutation; and (4) Flutamide had a stronger inhibiting effecton the RAS and a more pronounced beneficial action on cardiovascularorgans than the tfm mutation.
Acknowledgments
This work was supported by the BMBF grant 0310681B to M.B. andthe NSF grant IBN-0296060 to C.J. We thank Ms. Borowicz, Ms.Kuhlmann, Ms. Strauss, and Ms. Born for the measurement of plasmahormone levels.
Mendelsohn ME, Karas RH: The protective effects of estrogen on the cardiovascular system. N Engl J Med 340: 1801–1811, 1999[Free Full Text]
Chen YF: Sexual dimorphism of hypertension. Curr Opin Nephrol Hypertens 5: 181–185, 1996[CrossRef][Medline]
Reckelhoff JF: Gender differences in the regulation of blood pressure. Hypertension 37: 1199–1208, 2001[Abstract/Free Full Text]
Hayward CS, Webb CM, Collins P: Effect of sex hormones on cardiac mass. Lancet 357: 1354–1356, 2001[CrossRef][Medline]
Reckelhoff JF, Granger JP: Role of androgens in mediating hypertension and renal injury. Clin Exp Pharmacol Physiol 26: 127–131, 1999[CrossRef][Medline]
Reckelhoff JF, Zhang H, Granger JP: Decline in renal hemodynamic function in aging SHR: role of androgens. Hypertension 30: 677–681, 1997[Abstract/Free Full Text]
Ely DL, Salisbury R, Hadi D, Turner M, Johnson ML: Androgen receptor and the testes influence hypertension in a hybrid rat model. Hypertension 17: 1104–1110, 1991[Abstract/Free Full Text]
Ganten U, Schroder G, Witt M, Zimmermann F, Ganten D, Stock G: Sexual dimorphism of blood pressure in spontaneously hypertensive rats: Effects of anti-androgen treatment. J Hypertens 7: 721–726, 1989[Medline]
Mullins JJ, Peters J, Ganten D: Fulminant hypertension in transgenic rats harbouring the mouse Ren-2 gene. Nature 344: 541–544, 1990[CrossRef][Medline]
Bader M, Peters J, Baltatu O, Muller DN, Luft FC, Ganten D: Tissue renin-angiotensin systems: New insights from experimental animal models in hypertension research. J Mol Med 79: 76–102, 2001[CrossRef][Medline]
Kumai T, Tanaka M, Tateishi T, Watanabe M, Nakura H, Asoh M, Kobayashi S: Effects of anti-androgen treatment on the catecholamine synthetic pathway in the adrenal medulla of spontaneously hypertensive rats. Naunyn Schmiedebergs Arch Pharmacol 357: 620–624, 1998[CrossRef][Medline]
Baltatu O, Janssen BJ, Bricca G, Plehm R, Monti J, Ganten D, Bader M: Alterations in blood pressure and heart rate variability in transgenic rats with low brain angiotensinogen. Hypertension 37: 408–413, 2001[Abstract/Free Full Text]
Yarbrough WG, Quarmby VE, Simental JA, Joseph DR, Sar M, Lubahn DB, Olsen KL, French FS, Wilson EM: A single base mutation in the androgen receptor gene causes androgen insensitivity in the testicular feminized rat. J Biol Chem 265: 8893–8900, 1990[Abstract/Free Full Text]
Barberis C, Tribollet E: Vasopressin and oxytocin receptors in the central nervous system. Crit Rev Neurobiol 10: 119–154, 1996[Medline]
Baltatu O, Lippoldt A, Hansson A, Ganten D, Bader M: Local renin-angiotensin system in the pineal gland. Brain Res Mol Brain Res 54: 237–242, 1998[Medline]
Springate JE, Feld LG, Ganten D: Renal function in hypertensive rats transgenic for mouse renin gene. Am J Physiol 266: F731–F737, 1994
Van Liew JB, Davis FB, Davis PJ, Noble B, Bernardis LL: Calorie restriction decreases microalbuminuria associated with aging in barrier-raised Fischer 344 rats. Am J Physiol 263: F554–F561, 1992
Cerasola G, Cottone S, Mule G, Nardi E, Mangano MT, Andronico G, Contorno A, Li VM, Galione P, Renda F, Piazza G, Volpe V, Lisi A, Ferrara L, Panepinto N, Riccobene R: Microalbuminuria, renal dysfunction and cardiovascular complication in essential hypertension. J Hypertens 14: 915–920, 1996[Medline]
Crofton JT, Ota M, Share L: Role of vasopressin, the renin-angiotensin system and sex in Dahl salt-sensitive hypertension. J Hypertens 11: 1031–1038, 1993[Medline]
Crofton JT, Share L: Gonadal hormones modulate deoxycorticosterone-salt hypertension in male and female rats. Hypertension 29: 494–499, 1997[Abstract/Free Full Text]
Ouchi Y, Share L, Crofton JT, Iitake K, Brooks DP: Sex difference in pressor responsiveness to vasopressin and baroreflex function in DOC-salt hypertensive rats. J Hypertens 6: 381–387, 1988[Medline]
Haywood JR, Hinojosa LC: Sexual dimorphism of sodium-sensitive renal-wrap hypertension. Hypertension 30: 667–671, 1997[Abstract/Free Full Text]
Guo GB, Abboud FM: Impaired central mediation of the arterial baroreflex in chronic renal hypertension. Am J Physiol 246: H720–H727, 1984
Bohm M, Lee M, Kreutz R, Kim S, Schinke M, Djavidani B, Wagner J, Kaling M, Wienen W, Bader M, Ganten D: Angiotensin II receptor blockade in TGR(mREN2)27: Effects of renin-angiotensin-system gene expression and cardiovascular functions. J Hypertens 13: 891–899, 1995[CrossRef][Medline]
Teisman AC, Pinto YM, Buikema H, Flesch M, Bohm M, Paul M, van GW: Dissociation of blood pressure reduction from end-organ damage in TGR(mREN2)27 transgenic hypertensive rats. J Hypertens 16: 1759–1765, 1998[CrossRef][Medline]
Kon Y, Endoh D, Murakami K, Yamashita T, Watanabe T, Hashimoto Y, Sugimura M: Expression of renin in coagulating glands is regulated by testosterone. Anat Rec 241: 451–460, 1995[CrossRef][Medline]
Chen YF, Naftilan AJ, Oparil S: Androgen-dependent angiotensinogen and renin messenger RNA expression in hypertensive rats. Hypertension 19: 456–463, 1992[Abstract/Free Full Text]
Caplea A, Seachrist D, Dunphy G, Ely D: Sodium-induced rise in blood pressure is suppressed by androgen receptor blockade. Am J Physiol Heart Circ Physiol 280: H1793–H1801, 2001[Abstract/Free Full Text]
Reckelhoff JF, Zhang H, Srivastava K: Gender differences in development of hypertension in spontaneously hypertensive rats: Role of the renin-angiotensin system. Hypertension 35: 480–483, 2000[Abstract/Free Full Text]
Brogden RN, Chrisp P: Flutamide. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic use in advanced prostatic cancer. Drugs Aging 1: 104–115, 1991[Medline]
Goldspiel BR, Kohler DR: Flutamide: An antiandrogen for advanced prostate cancer. DICP 24: 616–623, 1990[Abstract]
Marchetti B, Labrie F: Characteristics of flutamide action on prostatic and testicular functions in the rat. J Steroid Biochem 29: 691–698, 1988[CrossRef][Medline]
Crews JK, Khalil RA: Gender-specific inhibition of Ca2+ entry mechanisms of arterial vasoconstriction by sex hormones. Clin Exp Pharmacol Physiol 26: 707–715, 1999[CrossRef][Medline]
Costarella CE, Stallone JN, Rutecki GW, Whittier FC: Testosterone causes direct relaxation of rat thoracic aorta. J Pharmacol Exp Ther 277: 34–39, 1996[Abstract/Free Full Text]
Yue P, Chatterjee K, Beale C, Poole WP, Collins P: Testosterone relaxes rabbit coronary arteries and aorta. Circulation 91: 1154–1160, 1995[Abstract/Free Full Text]
Ceballos G, Figueroa L, Rubio I, Gallo G, Garcia A, Martinez A, Yanez R, Perez J, Morato T, Chamorro G: Acute and nongenomic effects of testosterone on isolated and perfused rat heart. J Cardiovasc Pharmacol 33: 691–697, 1999[CrossRef][Medline]
Matsuda K, Ruff A, Morinelli TA, Mathur RS, Halushka PV: Testosterone increases thromboxane A2 receptor density and responsiveness in rat aortas and platelets. Am J Physiol 267: H887–H893, 1994
Wilson JD, Griffin JE, George FW, Leshin M: The endocrine control of male phenotypic development. Aust J Biol Sci 36: 101–128, 1983[Medline]
Stanley AJ, Gumbreck LG, Allison JE, Easley RB: Male pseudohermaphroditism in the laboratory Norway rat. Recent Prog Horm Res 29: 43–64, 1973
Yamada K, Iyer SN, Chappell MC, Brosnihan KB, Fukuhara M, Ferrario CM: Differential response of angiotensin peptides in the urine of hypertensive animals. Regul Pept 80: 57–66, 1999[CrossRef][Medline]
Farhat MY, Lavigne MC, Ramwell PW: The vascular protective effects of estrogen. FASEB J 10: 615–624, 1996[Abstract]
Silberberg SD, Magleby KL: Beating the odds with Big K. Science 285: 1859-1860, 1999[Free Full Text]
Valverde MA, Rojas P, Amigo J, Cosmelli D, Orio P, Bahamonde MI, Mann GE, Vergara C, Latorre R: Acute activation of Maxi-K channels (hSlo) by estradiol binding to the beta subunit [see comments]. Science 285: 1929–1931, 1999[Abstract/Free Full Text]
Schunkert H, Danser AH, Hense HW, Derkx FH, Kurzinger S, Riegger GA: Effects of estrogen replacement therapy on the renin-angiotensin system in postmenopausal women. Circulation 95: 39–45, 1997[Abstract/Free Full Text]
He XR, Wang W, Crofton JT, Share L: Effects of 17beta-estradiol on sympathetic activity and pressor response to phenylephrine in ovariectomized rats. Am J Physiol 275: R1202–R1208, 1998
Fischer M, Baessler A, Schunkert H: Renin angiotensin system and gender differences in the cardiovascular system. Cardiovasc Res 53: 672–677, 2002[Abstract/Free Full Text]
Reinhart GA, Lohmeier TE, Hord CE, Jr: Hypertension induced by chronic renal adrenergic stimulation is angiotensin dependent. Hypertension 25: 940–949, 1995[Abstract/Free Full Text]
Received for publication April 25, 2002.
Accepted for publication July 18, 2002.
This article has been cited by other articles:
K. D. Pendergrass, N. T. Pirro, B. M. Westwood, C. M. Ferrario, K. B. Brosnihan, and M. C. Chappell Sex differences in circulating and renal angiotensins of hypertensive mRen(2).Lewis but not normotensive Lewis rats
Am J Physiol Heart Circ Physiol,
July 1, 2008;
295(1):
H10 - H20.
[Abstract][Full Text][PDF]
D. H. T. IJpelaar, A. Schulz, K. Koop, M. Schlesener, J. A. Bruijn, D. Kerjaschki, R. Kreutz, and E. de Heer Glomerular hypertrophy precedes albuminuria and segmental loss of podoplanin in podocytes in Munich-Wistar-Fromter rats
Am J Physiol Renal Physiol,
April 1, 2008;
294(4):
F758 - F767.
[Abstract][Full Text][PDF]
R. Iliescu and J. F. Reckelhoff Sex and the Kidney
Hypertension,
April 1, 2008;
51(4):
1000 - 1001.
[Full Text][PDF]
J. F. Reckelhoff, L. L. Yanes, R. Iliescu, L. A. Fortepiani, and J. P. Granger Testosterone supplementation in aging men and women: possible impact on cardiovascular-renal disease
Am J Physiol Renal Physiol,
November 1, 2005;
289(5):
F941 - F948.
[Abstract][Full Text][PDF]
Y. Ikeda, K.-i. Aihara, T. Sato, M. Akaike, M. Yoshizumi, Y. Suzaki, Y. Izawa, M. Fujimura, S. Hashizume, M. Kato, et al. Androgen Receptor Gene Knockout Male Mice Exhibit Impaired Cardiac Growth and Exacerbation of Angiotensin II-induced Cardiac Fibrosis
J. Biol. Chem.,
August 19, 2005;
280(33):
29661 - 29666.
[Abstract][Full Text][PDF]
S. Nagao, M. Kusaka, K. Nishii, T. Marunouchi, H. Kurahashi, H. Takahashi, and J. Grantham Androgen Receptor Pathway in Rats with Autosomal Dominant Polycystic Kidney Disease
J. Am. Soc. Nephrol.,
July 1, 2005;
16(7):
2052 - 2062.
[Abstract][Full Text][PDF]
M. C. Blendea, D. Jacobs, C. S. Stump, S. I. McFarlane, C. Ogrin, G. Bahtyiar, S. Stas, P. Kumar, Q. Sha, C. M. Ferrario, et al. Abrogation of oxidative stress improves insulin sensitivity in the Ren-2 rat model of tissue angiotensin II overexpression
Am J Physiol Endocrinol Metab,
February 1, 2005;
288(2):
E353 - E359.
[Abstract][Full Text][PDF]
O. Baltatu, C. Cayla, R. Iliescu, D. Andreev, and M. Bader Abolition of End-Organ Damage by Antiandrogen Treatment in Female Hypertensive Transgenic Rats
Hypertension,
March 1, 2003;
41(3):
830 - 833.
[Abstract][Full Text][PDF]
J. Neugarten Gender and the Progression of Renal Disease
J. Am. Soc. Nephrol.,
November 1, 2002;
13(11):
2807 - 2809.
[Full Text][PDF]
Top
Abstract
Introduction
-actin. 
X174 DNA digested with HaeIII was used a size marker.
