Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vezzoli, G.
Right arrow Articles by Brandi, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vezzoli, G.
Right arrow Articles by Brandi, M. L.
J Am Soc Nephrol 13:2517-2523, 2002
© 2002 American Society of Nephrology

Influence of Calcium-Sensing Receptor Gene on Urinary Calcium Excretion in Stone-Forming Patients

Giuseppe Vezzoli*, Annalisa Tanini{dagger}, Luigi Ferrucci{ddagger}, Laura Soldati§, Cristiana Bianchin*, Francesco Franceschelli{dagger}, Cecilia Malentacchi, Berardino Porfirio, Donatella Adamo§, Annalisa Terranegra§, Alberto Falchetti{dagger}, Daniele Cusi§, Giuseppe Bianchi* and Maria Luisa Brandi{dagger}

*Division of Nephrology Dialysis and Hypertension, Postgraduate School of Nephrology, Ateneo Vita e Salute, IRCCS San Raffaele Hospital, Milan, Italy; {dagger}Department of Internal Medicine, University of Florence, Florence, Italy; {ddagger}Laboratory of Clinical Epidemiology, INRCA Geriatric Department, Florence, Italy; §Department of Biomedical Sciences and Technology, University of Milan, Milan, Italy; and Department of Clinical Physiopathology, University of Florence, Florence, Italy.

Correspondence to Dr. Giuseppe Vezzoli, Divisione Nefrologia, Dialisi ed Ipertensione, IRCCS Ospedale San Raffaele, via Olgettina 60, 20132, Milano, Italy. Phone: 39-2-26433892; Fax: 39-2-26432384


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. Calcium-sensing receptor (CaSR) is a plasma membrane protein that regulates tubular reabsorption of Ca. To establish its role in idiopathic hypercalciuria, the association of urinary Ca excretion with the polymorphisms of CASR gene has been studied in healthy subjects and in hypercalciuric and normocalciuric Ca stone formers. CASR exon 7 single nucleotide polymorphisms (SNP), G/T at codon 986, G/A at codon 990, and C/G at codon 1011, were evaluated by PCR amplification and direct sequencing in 97 normocalciuric stone formers, 134 hypercalciuric stone formers, and 101 normocalciuric healthy controls. Four haplotypes were defined on the basis of CASR gene SNP: haplotype 1 was characterized by the most frequent sequence; haplotypes 2, 3, or 4 by the presence of a single polymorphic variant at codon 986, 990, or 1011, respectively. The relative risk of hypercalciuria was calculated with multinomial logistic regression and was significantly increased only in individuals carrying haplotype 3 (Odds ratio, 13.0 [95% confidence interval, 1.7 to 99.4]). Accordingly, Ca excretion was higher in subjects bearing haplotype 3, whereas those bearing haplotype 2 showed a slight increase of plasma Ca concentration. Multiple regression analysis showed that haplotype 3 explained 4.1% of the total variance of Ca excretion and 12.6% of the variance explained by the variables considered in the study. In conclusion, CASR gene could be a component of the complex genetic background regulating Ca excretion. Arg990Gly polymorphism could facilitate activation of CaSR and increase Ca excretion and susceptibility to idiopathic hypercalciuria.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Calcium-sensing receptor (CaSR) is a plasma membrane protein that regulates parathyroid hormone (PTH) secretion by parathyroid cells and Ca reabsorption by kidney tubular cells (1–3). It is activated by the increase of extracellular concentration of Ca ions, which bind to the large extracellular N-terminal domain of the CaSR molecule (1,2). CaSR exerts its cellular activity through the stimulation of a G protein by its intracellular tail (2), which leads to the inhibition of PTH production (3) and tubular Ca reabsorption (2,4). In addition, CaSR influences intestinal Ca absorption (5), bone remodeling (6,7), and even nervous transmission (8).

Inactivating mutations of CASR gene account for disorders characterized by hypocalciuria and hypercalcemia due to the altered control of PTH release and tubular Ca reabsorption: heterozygotes develop benign familial hypocalciuric hypercalcemia, whereas homozygotes are affected by severe neonatal hyperparathyroidism (9,10). Through opposite mechanisms, mutations enhancing CaSR activity lead to disorders characterized by hypocalcemia and hypercalciuria (11).

Three clustered single nucleotide polymorphisms (SNP), causing nonconservative amino acid changes, have been described on exon 7, encoding the intracellular domain of CaSR (12,13). The most common SNP consists of the substitution of a guanine with a thymine at codon 986, leading to the Ala986Ser variant (12,13). The other two SNP are less frequent: an adenine/guanine substitution at codon 990 determines the Arg990Gly variant; a cytosine/guanine substitution at codon 1011 determines the Gln1011Glu variant. The functional effects of these amino acid changes are yet unknown, but a slight increase of plasma Ca concentrations, not associated with symptoms, was found in healthy subjects carrying the 986Ser allele (12).

Studies in humans (9) and in canine tubular cells (4) showed an inhibitory effect of CaSR on cellular Ca transport, suggesting that CaSR plays a key-role in the regulation of Ca excretion. In keeping with these observations, CASR gene has been considered a candidate for idiopathic hypercalciuria (14), a familial disorder predisposing to Ca kidney stones and characterized by increased Ca excretion in the presence of normal Ca concentrations in plasma (15,16). This view has been contrasted by a study in Ca stone-forming French-Canadian sibling pairs, finding no linkage between idiopathic hypercalciuria and CASR gene locus (17). However, even though CASR gene may not be a major determinant in idiopathic hypercalciuria, its polymorphisms may influence tubular Ca reabsorption capacity. Therefore, in the present study, the association of urinary Ca excretion with CASR gene SNP was evaluated in an Italian population of healthy subjects and of hypercalciuric and normocalciuric Ca stone formers.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Patients
Ninety-seven normocalciuric stone formers (65 male patients and 32 female patients; weight, 69 ± 1.2 kg; age, 45 ± 1.5 yr), 134 hypercalciuric stone formers (78 male patients and 56 female patients; weight, 69 ± 1.1 kg; age, 47 ± 1.1 yr), and 101 normocalciuric healthy controls (58 male patients and 43 female patients; weight, 72 ± 1.2 kg; age, 46 ± 1.2 yr) were included in the study. These subjects were white and were characterized by no polymorphic variants or by the presence of a polymorphic variant at one single CASR exon 7 SNP. According to these criteria, six individuals (two healthy subjects, one normocalciuric, and three hypercalciuric stone formers), who were double heterozygotes for two CASR exon 7 SNP, were not included among the subjects enrolled for the study.

Stone formers were recruited at their first visit at the Outpatient Stone Clinic of San Raffaele Hospital in Milan, Italy. To be included in the study, stone formers had to have produced at least one Ca kidney stone and their plasma creatinine, sodium, potassium, and Ca concentrations had to be normal. All of them had to be able to lower urinary pH under 5.5. Stones present in patient urinary tract had to have diameter smaller than 5 mm. None of them had to have obstructive nephropathy or urinary tract dilatation, evaluated by echographic examination. Most of the patients (n = 150; 65%) were addressed to the clinic after lithotripsy and were studied at least 3 mo after lithotriptic treatment. The hospital’s protocol does not include any pharmacologic treatment for kidney stones immediately after lithotripsy, but only dietary counseling (increase of water intake). The other patients (n = 81; 35%) were sent to the Outpatient Clinic by attending physicians before starting any kind of treatment. In no case was a patient studied if he or she took any treatment for kidney stones (thiazide, citrate, or others) for at least 3 mo before the study. No patient had diseases other than kidney stone, and none took any long-term medications.

Healthy subjects were selected from the population recruited for the InCHIANTI study, an epidemiologic survey conduced in Greve and Bagno a Ripoli, two little towns near Florence. They were selected according to the following criteria: absence of hypercalciuria, age between 20 and 60 yr, no clinical diagnosis of hypertension, diabetes, dyslipidemia, stroke, coronary heart disease, kidney stones, and no treatment with drugs affecting Ca metabolism, like Ca salts or vitamin D. The rationale and methods of the InCHIANTI study have been previously reported (18).

Stone forming and healthy subjects were considered hypercalciuric when their 24-h Ca excretion was greater than 7.5 mmol in male patients or 6.25 mmol in female patients or greater than 0.1 mmol/kg of body weight independently of gender (19).

The study agrees with the indications of the Helsinki Declaration and was approved by San Raffaele Hospital Ethical Committee. All subjects gave informed consent to the study and genomic analysis.

Phenotyping
Total plasma concentration of Ca and 24-h Ca excretion were determined in healthy subjects and in stone-forming patients. In stone formers, 24-h excretion of phosphates and sodium, serum phosphate, plasma creatinine, and PTH and intestinal absorption of strontium were also measured. Intact PTH was determined by immunoradiometric assay (Nichols Institute). Strontium was used as a surrogate marker to assess intestinal Ca absorption. Intestinal strontium absorption was determined after an oral load, as described previously (20). Strontium (30.2 µmol of Sr per kg of body weight) was administered to patients in distilled water solution as chloride salt after overnight fast. Blood samples were drawn 60 min after strontium load ingestion, and strontium concentrations were measured in serum by atomic absorption spectrophotometer (Perkin-Elmer 4000; Perkin-Elmer, Norwalk, CT). Ion absorption was calculated as the incremental area (above baseline) under the serum strontium concentration-time curve, using the trapezoid method (mmol · L-1 · min).

Genotyping
Genomic DNA was isolated from peripheral blood cells by standard procedures. Mutation screening was carried out by denaturing gradient gel electrophoresis (DGGE) in hypercalciuric patients. The entire CASR coding sequence (exons 2 to 7) was amplified by the PCR. DNA amplification primers for each exon were designed on the basis of Pearce et al. and Vigouroux et al. (11,21); moreover, one of the two primers used in each PCR had the proper 5' end GC-tail to create a high melting temperature domain.

Samples were run on the Bio-Rad DCode denaturing gel electrophoresis system for mutation detection (Bio-Rad, Hercules, CA). The denaturing conditions were from 20% to 80%, whereas acrylamide concentration ranged from 6% to 10% depending on fragment length. Electrophoresis was performed at a constant temperature of 60°C at 120 V for 12 h. Gels were stained with ethidium bromide and were photographed with Kodak Digital Camera (Eastman Kodak, Rochester, NY).

Part of exon 7 of CASR gene, which comprises 3 SNP (G/T at codon 986, A/G at codon 990, and C/G at codon 1011), were evaluated by PCR amplification and direct sequencing. PCR was carried out using primers 5'CAGAAGGTCATCTTTGGCAGCGGCA3' and 5'TGCAGACCTGTTTCCTGGACGGTC3', sequences that flank the polymorphic site giving an amplimer of 206 bp. Purified PCR products served as template for the sequence reaction, which was performed using a ready reaction mix (ABI PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Foster City, CA) and the same forward primer as for PCR. Sequence products were generated during 25 cycles of the following steps: 15 s at 96°C, 10 s at 50°C, and 2 min at 60°C. Unincorporated dye terminators were removed by ethanol/sodium acetate precipitation. Afterward, dyed samples were denatured in 20 µl of Template Suppression Reagent (TSR, Applied Biosystems) at 95°C for 10 min and cooled on ice for 15 min. The ABI PRISM 310 Genetic Analyzer (Applied Biosystems) was used for capillary electrophoresis. All sequences were analyzed for comparison using resident software.

Four haplotypes were defined on the basis of exon 7 SNP of CASR gene (Table 1): they were respectively characterized by the most common sequence (haplotype 1) or by the presence of one single polymorphic variant, respectively at 986 (haplotype 2), 990 (haplotype 3) and 1011 (haplotype 4). According to these criteria, six double heterozygotes at CASR exon 7 SNP were not considered, as already mentioned. Participants in the study were divided into four groups according to their haplotypes: group 1 was composed by Ala986, Azg990, and Gen1011 homozygotes; group 2 was composed by 986Ser homozygotes and Ala986Ser heterozygotes; group 3 was composed by 990Gly homozygotes and Arg990Gly heterozygotes; group 4 was composed by Gln1011Glu heterozygotes (Table 1).


View this table:
[in this window]
[in a new window]

  		Table 1. Patients and haplotypesa
 
Statistical Analyses
Distribution of CASR genotypes was compared in normocalciuric and hypercalciuric stone formers and healthy subjects by multinomial logistic regression. Relative risk to be hypercalciuric was estimated by the calculation of the odds ratio (OR) and its 95% confidence interval (95% CI).

Quantitative variables were reported in the text as mean ± SE. Differences of the means were tested by t test or one-way ANOVA with Scheffe’s post-hoc multiple comparisons test.

Dependence of Ca excretion or plasma Ca concentration on CASR haplotypes was evaluated in stone formers by multiple regression analysis. To take into account the effect of possible confounders, we used a two-step multiple regression model in which the confounders were entered at the first step and CASR haplotypes at the second step. Statistical analyses were conducted at the {alpha} = 0.05 level and were two-tailed. All analyses were performed using the SPSS 10 statistical package (SPSS Inc., Chicago, IL).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Frequency of CaSR Polymorphisms
Preliminary analysis by DDGE showed no abnormal mobility pattern of CASR gene in either hypercalciuric and normocalciuric stone formers, but the already described shifts of exon 7 (data not shown). Genotype frequencies at polymorphic sites did not deviate from those expected according to Hardy-Weinberg equilibrium in both healthy subjects and stone formers. Furthermore, no linkage disequilibrium was observed among the three SNP (data not shown). In the whole population, haplotype 1 represented the most frequent sequence of CASR gene exon 7.

Participants were divided into four groups, each comprising homozygotes and heterozygotes for each CASR gene exon 7 haplotype (Table 1). Their distribution is shown in Table 2. To test the relationship between CASR haplotypes and clinical classification (healthy subjects, normocalciuric stone formers, and hypercalciuric stone formers), a multinomial logistic regression was performed with clinical classification as the dependent variable and haplotype group as the factor chosen for the design. Healthy controls were the reference population in the analysis. Relative risk to be hypercalciuric (Table 3) was significantly increased in haplotype 3 subjects (OR, 13; 95% CI, 1.7 to 99.4).


View this table:
[in this window]
[in a new window]

  		Table 2. Distribution of individuals with different CASR haplotypes was compared in healthy subjects and normocalciuric or hypercalciuric stone formersa
 

View this table:
[in this window]
[in a new window]

  		Table 3. Results of multinomial logistic regression in hypercalciuric and normocalciuric stone formers, with healthy controls as the reference population in the analysis
 
Association between Haplotypes and Phenotypes in the Whole Population
The quantitative variables were compared in individuals with different haplotypes. At first, healthy subjects and stone formers were considered together (Table 4). Ca excretion was higher in individuals carrying haplotype 3 (n = 16; 9.18 ± 0.95 mmol/24 h) than in those not carrying haplotype 3 (n = 316; 6.16 ± 0.19 mmol/24 h; P = 0.0005, t test). Although one-way ANOVA showed no significant difference in plasma Ca concentration between individual groups (Table 4), it was slightly higher in individuals carrying the haplotype 2 (n = 118; 2.37 ± 0.01 mmol/L) than in those not carrying haplotype 2 (n = 214; 2.35 ± 0.01 mmol/L; P = 0.047, t test). This difference was particularly marked in the 17 homozygotes for haplotype 2 (2.41 ± 0.02 mmol/L; P = 0.02 versus individuals not carrying haplotype 2, t test), whereas their Ca excretion was not increased (5.46 ± 0.89 mmol/24 h).


View this table:
[in this window]
[in a new window]

  		Table 4. Urinary Ca excretion and plasma Ca concentration in stone formers and healthy controls considered together and divided according to the haplotypes of CASR gene
 
Association between Haplotypes and Phenotypes in Stone Formers
Also when stone formers were considered alone (Table 5), Ca excretion remained significantly higher in haplotype 3 than in haplotype 1 patients or when compared with all patients not carrying haplotype 3 (n = 216; 7.23 ± 0.23 mmol/24 h; P = 0.007, t test). Stone formers carrying haplotype 2 had marginally significant higher plasma Ca concentration than those not carrying haplotype 2 (n = 157; 2.35 ± 0.01 mmol/L; P = 0.05, t test). A further increase of plasma Ca was observed in stone formers homozygous for haplotype 2 (n = 8; 2.41 ± 0.01), whereas urinary Ca excretion (7.06 ± 1.71 mmol/24 h) was not different from that of other groups.


View this table:
[in this window]
[in a new window]

  		Table 5. Values of phenotypes were compared in stone formers with different haplotypes of CASR gene
 
Forty-three hypercalciuric stone formers carried haplotype 2; their plasma Ca concentration (2.39 ± 0.01 mmol/L) and Ca excretion (10.38 ± 0.51 mmol/24 h) were higher than in the other 91 hypercalciuric stone formers (2.35 ± 0.01 mmol/L [P = 0.026] and 9.13 ± 0.26 mmol/24 h [P = 0.016, t test], respectively). Only three homozygotes for haplotype 2 were detected among hypercalciuric stone formers (plasma Ca: 2.43 ± 0.02 mmol/L; Ca excretion 11.97 ± 2.54 mmol/24 h).

Multiple Regression
The capacity of CaSR haplotypes to explain variance of Ca excretion was analyzed by multiple regression in stone formers. Independent variables were entered in the regression model in two subsequent steps. In the first step, potential confounders of the association between haplotype and Ca excretion were entered in the model: namely, they were body weight, age, plasma Ca, plasma PTH, serum phosphate, plasma creatinine, intestinal strontium absorption. and sodium excretion. In the second step, haplotype 2 or haplotype 3 was entered and added to the other independent variables.

Sodium excretion, body weight, plasma creatinine, and enteral absorption of strontium associated with Ca excretion (r2 = 0.284; F = 6.1; P = 0.0001). Haplotype 3 significantly improved the percentage of explained variance by 12.6% (cumulative r2 = 0.326; F = 6.54; P = 0.0001; r2 change = 0.041; F change = 7.5, P = 0.007). Haplotype 2 did not contribute to the variance of Ca excretion (r2 change = 0.007; F change = 1.21; P = 0.27). Regression analysis for plasma Ca was performed with the same model and the same independent variables used for calciuria analysis, but including calciuria at the place of plasma Ca concentrations. No variables other than haplotype 2 showed significant association with the plasma Ca concentration (cumulative r2 = 0.101; F = 1.52; P = 0.15; r2 change = 0.04; F change=5.58, P = 0.02).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Several pieces of evidence indicate that CaSR plays an important role in the regulation of tubular Ca reabsorption (1,2,4). In keeping with these studies, CASR gene has been proposed as a candidate gene for idiopathic hypercalciuria (14). However, testing this hypothesis, Petrucci et al. (17) found no linkage of idiopathic hypercalciuria and Ca nephrolithiasis with CASR gene locus when using an affected sib-pair approach in a French-Canadian population. Indeed, DGGE analysis of the entire coding sequence of CASR gene failed to detect abnormal mobility patterns suggestive for mutations in hypercalciuric patients, with the exception of the already known SNP on exon 7 (10). Accordingly, a previous DNA sequencing study found no point mutations of CASR in members of French hypercalciuric families (22).

The functional importance of exon 7 polymorphisms has been suggested by the lower plasma Ca concentration in healthy subjects carrying the allele 986Ser (12) and by the lower plasma PTH level in Japanese uremic patients carrying the allele 990Gly (23). Genetic polymorphisms of CASR exon 7 could account for the phenotype variability of a quantitative multifactorial trait such as Ca excretion. Therefore, in the present study, we evaluated the distribution of these SNP in healthy subjects and in a large cohort of stone formers, comprising a high number of hypercalciuric patients. We found that a polymorphic variant of the CASR gene was associated with the increase of Ca excretion and could contribute to the Ca excretion variability in our patients.

Genotypes of exon 7 variants were distributed according to the Hardy-Weinberg equilibrium both in stone formers and healthy subjects. Ala986Ser was the most frequent SNP, and its frequency in our populations was close to that previously reported in other white populations (12,13,25,26). Haplotype 3 was significantly more frequent in hypercalciuric stone formers than in normocalciuric patients or healthy subjects, so that it increased the probability to be hypercalciuric for the carriers. This suggests that Arg990Gly polymorphism affects Ca excretion, the 990Gly allele predisposing to idiopathic hypercalciuria. Indeed, haplotype 3 explains a small but significant proportion of Ca excretion variance in stone formers. It equals 12.6% of the explained variance and 4.1% of the total variance of urinary Ca excretion, in agreement with its multifactorial nature (27,28). The low explained variance excludes CASR as a major gene for idiopathic hypercalciuria (24,29).

Therefore, CASR gene is one of the genetic components modulating Ca excretion. The minor contribution of CASR gene to Ca excretion could explain why no linkage was shown between urinary Ca excretion and CASR locus in a study on French-Canadian stone-forming sib-pairs (17). However, the different genetic background in Canadian and Italian populations could modify the weight of CASR in Ca excretion determination (24,30). Furthermore, that study could be underpowered for the small genotype relative risk we observed (29). To reduce the influence of unknown genetic components or unevenness with controls, we compared hypercalciuric stone formers with two normocalciuric groups: healthy subjects and stone formers (30). Patients and controls were recruited in different areas: Lombardy and Tuscany. Previous studies with several polymorphic markers failed to disclose genetic heterogeneity among Italian regions, except for Sardinia (31). Therefore, our samples of healthy subjects and patients appear to be representative of Italian population, excluding the risk of genetic stratification.

The activation of CaSR by extracellular Ca inhibits tubular Ca reabsorption acting directly on ion transport (2,4). We propose that the 990Gly allele increases CaSR sensitivity or response to Ca ions. Accordingly, PTH secretion could be more inhibited by the 990Gly allele, in agreement with previous findings in uremic patients (23).

The contribution of Ala986Ser polymorphism to plasma Ca variance is confirmed in the present study (12). Although not corrected for serum albumin, plasma Ca was slightly but significantly higher in individuals carrying 986Ser allele. This association suggests that the inhibitory activity of CaSR on tubular Ca reabsorption and PTH secretion be depressed in subjects carrying haplotype 2 (1). In spite of these effects, the increase of plasma Ca was coupled with elevated Ca excretion in hypercalciuric patients carrying haplotype 2. A possible interpretation of these findings is that the decreased tubular Ca reabsorption, characterizing hypercalciuric patients, could overcome the enhancing effect of haplotype 2 on tubular Ca transport. In addition, the larger glomerular filtration of Ca, associated with increased Ca concentration in blood, could facilitate Ca loss in these patients (1,4). Conversely, in normocalciuric subjects carrying haplotype 2, the increase of filtered Ca could be balanced by the increased reabsorptive capacity.

Previous studies revealed that patients with idiopathic hypercalciuria exhibited a decreased axial and peripheral bone density (32,33), increased bone resorption (34), and histologic features of high bone turnover (35). These findings suggest that an abnormality in bone remodeling could be involved in the mechanisms leading to excessive Ca excretion. Polymorphisms of CASR gene could exert a direct influence on Ca metabolism in bone cells (6,7), and two studies demonstrated the association of CASR gene polymorphisms with mineral density at different bone sites (26,36). This suggests a potential role of CASR gene variants on bone reabsorption in idiopathic hypercalciuria.

Enteral absorption of Ca is typically increased in hypercalciuric patients (26) and could be influenced by CaSR as well (5). Its alteration was proposed as the primary event in hypercalciuria (16), but our results do not support any relation among CASR gene polymorphisms and intestinal Ca absorption, tested using strontium as a surrogate marker.

In conclusion, CASR gene could be considered as a component of the genetic background regulating Ca excretion. Arg990Gly polymorphism could produce a gain-of-function for CaSR that could increase Ca excretion and the susceptibility to idiopathic hypercalciuria. Ala986Ser polymorphism appears to affect Ca concentration in blood, possibly through a decrease in CaSR activity, which could cause a further increase of Ca excretion in hypercalciuric patients. Future studies will attempt to evaluate the function of these polymorphisms through in vitro analyses.


   Acknowledgments
 
This study was supported by funds from Ministry of Education, University and Scientific Research (Cofin 1999, protocol No. 9906217489-003) and Research Institute San Raffaele Hospital, Milan, Italy.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brown EM: Physiology and pathophysiology of the extracellular calcium-sensing receptor. Am J Med 106: 238–253, 1999[CrossRef][Medline]
  2. Riccardi D, Park JI, Lee WS, Gamba G, Brown EM, Hebert SC: Cloning and functional expression of a rat kidney extracellular calcium/polyvalent cation-sensing receptor. Proc Natl Acad Sci USA 92: 131–135, 1995[Abstract/Free Full Text]
  3. Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A, Lytton J, Herbert C: Cloning and characterization of an extracellular Ca-sensing receptor from bovine parathyroid. Nature 366: 575–580, 1993[CrossRef][Medline]
  4. Blankenship KA, William JJ, Lawrence MS, McLeish KR, Dean WL, Arthur JM: The calcium-sensing receptor regulates calcium absorption in MDCK cells by inhibition of PMCA. Am J Physiol Renal Physiol 280: F815–F822, 2001[Abstract/Free Full Text]
  5. Chattopadhyay N, Cheng I, Rogers K, Riccardi D, Hall A, Diaz R, Herbert SC, Soybel DI, Brown EM: Identification and localization of extracellular Ca-sensing receptor in rat intestine. Am J Physiol Gastroint Liver Physiol 274: G122–G130, 1998[Abstract/Free Full Text]
  6. Yamaguchi T, Chattopadhyay N, Kifor O, Ye C, Vassilev PM, Sanders JL, Brown EM: Expression of extracellular calcium-sensing receptor in human osteoblastic MG-63 cell line. Am J Physiol Cell Physiol 280: C382–C393, 2001[Abstract/Free Full Text]
  7. Katanani M, Sugimoto T, Kanzawa M, Yano S, Chiara K: Hogh extracellular calcium inhibits osteoclast-like cell formation by directly acting on the calcium-sensing receptor existing in osteoclast precursor cells. Biochem Biophys Res Comm 261: 144–148, 1999[CrossRef][Medline]
  8. Ruat M, Molliver ME, Snowman AM, Snyder SH: Calcium sensing receptor: Molecular cloning in rat and localization to nerve terminals. Proc Natl Acad Sci USA 92: 3161–3165, 1995[Abstract/Free Full Text]
  9. Pollak MR, Brown EM, Chou YH, Herbert SC, Marx SJ, Steinmann B, Seidman CE: Mutation in the human Ca-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 75: 1237–1239, 1993[Medline]
  10. Pearce SHS, Trump D, Wooding C, Besser GM, Chew SL, Grant DB, Heath DA, Hughes IA, Paterson CR, Whyte MP, Thakker RV: Calcium-sensing receptor mutations in familial benign hypercalcemia and neonatal hyperparathyroidism. J Clin Invest 96: 2683–2692, 1995
  11. Pearce SH, Williamson C, Kifor, Bai M, Coulthard MG, Davies M, Lewis-Barbed N, McCredie D, Powell H, Kendall-Taylor P, Brown EM, Thakker RV: A familial syndrome of hypocalcemia with hypercalciuria due to mutation in the calcium-sensing receptor. New Engl J Med 335: 1115–1122, 1996[Abstract/Free Full Text]
  12. Cole DEC, Peltekova VD, Rubin LA, Hawker GA, Virth R, Hwang DM, Evrovski J, Hendy GN: A986S polymorphism of the calcium-sensing receptor and circulating calcium concentrations. Lancet 353: 112–115, 1998
  13. Heath H, Oldberg S, Jackson CE, Teh BT, Hayward N, Larsson C, Buist NRM, Krapcho KJ, Hung BC, Capuano IV, Garret JE, Leppert MF: Clustered inactivating mutations and benign polymorphisms of calcium receptor gene in familial benign hypocalciuric hypercalcemia suggest receptor functional domains. J Clin Endocrinol Metab 8: 1312–1317, 1996
  14. Herbert S: Extracellular calcium-sensing receptor: Implications for calcium and magnesium handling in the kidney. Kidney Int 50: 2129–2139, 1996[Medline]
  15. Coe F, Parks JH, Moore ES: Familial idiopathic hypercalciuria. N Engl J Med 300: 337–340, 1979[Abstract]
  16. Breslau NA, Coe FL: Management of idiopathic hypercalciuria, In: Kidney Stones: Medical and Surgical Management, edited by Coe FL, Favus MJ, Pak CYC, Parks JH, Preminger GM, Philadelphia, Lippincott-Raven Company, 1996, pp 773–785
  17. Petrucci M, Scott P, Ouimet D, Trouvé ML, Proulx Y, Valiquette L, Guay G, Bonnardeaux A: Evaluation of the calcium-sensing receptor gene in idiopathic hypercalciuria and calcium nephrolithiasis. Kidney Int 58: 38–42, 2000[CrossRef][Medline]
  18. Ferrucci L, Bandinelli S, Benvenuti E, Di Iorio A, Macchi C, Harris T, Guralnik JM: Subsystems contributing to the decline in ability to walk: Bridging the gap between epidemiology and geriatric pracitce in the inCHIANTI study. J Am Geriatr Soc 48: 1618–1625, 2000[Medline]
  19. Hodgkinson A, Pyrah LN: The urinary excretion of calcium and inorganic phosphate in 344 patients with calcium stone of renal origin. Brit J Surg 46: 10–18, 1958
  20. Vezzoli G, Caumo A, Baragetti I, Zerbi S, Bellinzoni A, Centemero A, Rubinacci A, Moro GL, Adamo D, Bianchi G, Soldati L: Study of calcium metabolism in idiopayhic hypercalciuria by strontium oral load test. Clin Chem 45: 257–261, 1999[Abstract/Free Full Text]
  21. Vigouroux C, Bourut C, Guerci B, Ziegler O, Magré J, Capeau J, Meyer L: A new missense mutation in the calcium-sensing receptor in familial benign hypercalcaemia associated with partial lipoatrophy and insulin resistant diabetes. Clin Endocrinol 53: 393–398, 2000[CrossRef][Medline]
  22. Lerolle N, Coulet F, Lantz B, Paillard F, Houillier P, Soubrier F, Gattegno B, Jeunemaitre X, Ronco P, Rondeau E: No evidence for point mutations of the calcium-sensing receptor in familiar idiopathic hypercalciuria. Nephrol Dial Transplant 16: 2317–2322, 2001[Abstract/Free Full Text]
  23. Yano S, Sugimoto T, Kanzawa M, Tsukamoto T, Hattori T, Hattori S, Chihara K: Association of polymorphic alleles of the calcium-sensing receptor gene with parathyroid hormone secretion in hemodialysis patients. Nephron 85: 317–323, 2000[CrossRef][Medline]
  24. Falconer DS: Genetic constitution of a population. In: Introduction to Quantitative Genetics, 1st ed., edited by Falconer DS, Edinburgh, Oliver and Boyd, 1970, pp 5–22
  25. Miedlich S, Lamesch P, Mueller A, Paschke R: Frequency of the calcium-sensing receptor variant A986S in patients with primary hyperparathyroidism. Eur J Endocrinol 145: 421–427, 2001[Abstract]
  26. Lorentzon M, Lorentzon R, Lerner UH, Nordström P: Calcium sensing receptor gene polymorphism, circulating calcium concentrations and bone mineral density in healthy adolescent girls. Eur J Endocrinol 144: 257–261, 2001[Abstract]
  27. Lemann J: Calcium and phosphate metabolism: an overview in health and in calcium stone formers. In: Kidney Stones, Medical and Surgical Management, edited by Coe FL, Favus MJ, Pak CY, Parks JH, Preminger GM, Philadelphia, Lippincott-Raven Ltd. 1996,pp 259–288
  28. Goodman HO, Holmes RP, Assimos DG: Genetic factors in calcium oxalate stone disease. J Urol 153: 301–307, 1995[CrossRef][Medline]
  29. Risch NJ: Searching for genetic determinants in the new millennium. Nature 405: 847–856, 2000[CrossRef][Medline]
  30. Risch NJ, Merikangas K: The future of genetic studies of complex human diseases. Science 273: 1516–1518, 1996[Abstract/Free Full Text]
  31. Piazza A, Olivetti E, Barbanti M, Reali G, Domenici R, Giari A, Benciolini P, Caenazzo L, Cortivo P, Bestetti A: The distribution of some polymorphisms in Italy. Gene Geogr 3: 69–139, 1989[Medline]
  32. Pietschmann F, Breslau NA, Pak CY: Reduced vertebral bone density in hypercalciuric nephrolithiasis. J Bone Miner Res 7: 1383–1888, 1992[Medline]
  33. Barkin J, Wilson DR, Manuel MA, Bayley A, Murray T, Harrison J: Bone mineral content in idiopathic calcium nephrolitiasis. Min Electrolyte Metab 11: 19–24, 1985[Medline]
  34. Pacifici R, Rothstein M, Rifas L, Lau KW, Baylink DJ, Aviolo L, Hruska K: Increased monocyte interleukin-1 activity and decreased vertebral bone density in patients with fasting idiopathic hypercalciuria. J Clin Endocrinol Metab 71: 138–145, 1990[Abstract]
  35. Perry HM, Fallon MD, Bergfeld M, Tietelbaum SL, Avioli LV: Osteoporosis in young men: A syndrome of hypercalciuria and accelerated bone turnover. Arch Inter Med 142: 1295–1298, 1982[CrossRef][Medline]
  36. Tsukamoto K, Orimo H, Hosoi T, Miyao M, Ota N, Nakajima T, Yoshida H, Watanabe S, Suzuki T, Emi M: Association of bone mineral density with polymorphism of the human calcium-sensing receptor locus. Calcif Tissue Int 66: 181–183, 2000[CrossRef][Medline]
Received for publication April 2, 2002. Accepted for publication June 21, 2002.




This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
A. Scillitani, V. Guarnieri, C. Battista, S. De Geronimo, L. A. Muscarella, I. Chiodini, M. Cignarelli, S. Minisola, F. Bertoldo, C. M. Francucci, et al.
Primary Hyperparathyroidism and the Presence of Kidney Stones Are Associated with Different Haplotypes of the Calcium-Sensing Receptor
J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 277 - 283.
[Abstract] [Full Text] [PDF]

Home page
 Eur J EndocrinolHome page
S Corbetta, C Eller-Vainicher, M Filopanti, P Saeli, G Vezzoli, T Arcidiacono, P Loli, M L Syren, L Soldati, P Beck-Peccoz, et al.
R990G polymorphism of the calcium-sensing receptor and renal calcium excretion in patients with primary hyperparathyroidism.
Eur. J. Endocrinol., November 1, 2006; 155(5): 687 - 692.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
M. Bevilacqua, L. J. Dominguez, V. Righini, V. Valdes, R. Toscano, O. Sangaletti, T. Vago, G. Baldi, M. Barrella, and G. Bianchi-Porro
Increased Gastrin and Calcitonin Secretion after Oral Calcium or Peptones Administration in Patients with Hypercalciuria: A Clue to an Alteration in Calcium-Sensing Receptor Activity
J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1489 - 1494.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
O. W. Moe and O. Bonny
Genetic Hypercalciuria
J. Am. Soc. Nephrol., March 1, 2005; 16(3): 729 - 745.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Pathol.Home page
T M Reynolds
Best Practice No 181: Chemical pathology clinical investigation and management of nephrolithiasis
J. Clin. Pathol., February 1, 2005; 58(2): 134 - 140.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
A. Scillitani, V. Guarnieri, S. De Geronimo, L. A. Muscarella, C. Battista, L. D'Agruma, F. Bertoldo, C. Florio, S. Minisola, G. N. Hendy, et al.
Blood Ionized Calcium Is Associated with Clustered Polymorphisms in the Carboxyl-Terminal Tail of the Calcium-Sensing Receptor
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5634 - 5638.
[Abstract] [Full Text] [PDF]

Home page
 Nephrol Dial TransplantHome page
P. Houillier and M. Paillard
Calcium-sensing receptor and renal cation handling
Nephrol. Dial. Transplant., December 1, 2003; 18(12): 2467 - 2470.
[Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
K. K. Frick and D. A. Bushinsky
Molecular Mechanisms of Primary Hypercalciuria
J. Am. Soc. Nephrol., April 1, 2003; 14(4): 1082 - 1095.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vezzoli, G.
Right arrow Articles by Brandi, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vezzoli, G.
Right arrow Articles by Brandi, M. L.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP