Journal of the American Society of Nephrology
2007 JASN IMPACT FACTOR 7.111 HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP 
    advanced
CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Höcherl, K.
Right arrow Articles by Kurtz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Höcherl, K.
Right arrow Articles by Kurtz, A.
J Am Soc Nephrol 13:2427-2436, 2002
© 2002 American Society of Nephrology

Cyclosporine A Suppresses Cyclooxygenase-2 Expression in the Rat Kidney

Klaus Höcherl*, Franziska Dreher*, Helga Vitzthum{dagger}, Jens Köhler* and Armin Kurtz{dagger}

*Institut für Pharmakologie und {dagger}Physiologie, University of Regensburg, Regensburg, Germany.

Correspondence to Dr. Klaus Höcherl, Universität Regensburg, Institut für Pharmakologie, Universitätsstr. 31, D-93040 Regensburg, Germany. Phone: 49-941-9434772; Fax: 49-941-9434771;


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ABSTRACT. On the basis of recent evidence that the cyclooxygenase-2 (COX-2) gene promoter contains functional binding sites for the nuclear factor of activated T cells (NFAT) and that COX-2 is expressed in a regulated fashion in the kidney, this study aimed to assess the effect of immunosuppressants on COX-2 expression in the kidney. Therefore, Wistar-Kyoto rats were treated with cyclosporine A (CsA; 15 mg/kg per day) or tacrolimus (5 mg/kg per day) for 7 d each. Both drugs markedly lowered COX-2 expression while COX-1 expression remained unaltered. Furthermore, CsA blunted the increase of renocortical COX-2 expression in response to low salt intake or a combination of low-salt diet with the ACE inhibitor ramipril (10 mg/kg per day), which strongly stimulates renocortical COX-2 expression. At the same time, calcineurin inhibitors moderately enhanced basal as well as stimulated renin secretion and renin gene expression. These findings suggest that inhibition of calcineurin could be a crucial determinant for the regulated expression of COX-2 in the kidney. Inhibition of COX-2 expression may therefore at least in part account for the well-known adverse effects of immunosuppressants in the kidney. Moreover, our data suggest that the stimulation of the renin system by low salt and by ACE inhibitors is not essentially mediated by COX-2 activity. E-mail: klaus.hoecherl@chemie.uni-regensburg.de


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The family of cyclooxygenases (COX) comprises two members, COX-1 and COX-2, which convert arachidonic acid into endoperoxides, which are the direct substrates for prostanoid formation (1). Whereas COX-1 is considered to be a widely distributed and constitutively expressed enzyme, COX-2 is regarded as the more inducible form, which, for example, plays a major role in inflammation (1). It turned out, however, that COX-2 is already constitutively expressed in some organs, including the kidney (2). In renal tissue, COX-2 is significantly expressed in glomeruli, in the thick ascending limbs of Henle (TALH), including the macula densa regions and in medullary interstitial cells (2,3). There is convincing evidence to suggest that COX-derived prostanoids could be involved in the regulation of renin synthesis and secretion in the juxtaglomerular apparatus, as well as in the tubular salt and water handling (4,5). The involvement of COX-derived prostanoids in the control of the renin system was made even more intriguing by the findings that the expression of COX-2 in the TALH and in macula densa cells is physiologically regulated by salt intake, renal perfusion pressure, and AngII (2,6–8), and this expression of COX-2 is strikingly paralleled by the expression of renin. However, the molecular signaling pathways triggering COX-2 expression in TALH cells and also in medullary interstitial cells in response to the above mentioned stimuli are only poorly understood. Preliminary evidence has been elaborated for possible involvements of the MAP-kinase and NF-{kappa}B pathways (9–11). In fact, the COX-2 gene promoter contains, apart from a classical TATA box, an E-box and a CRE-element, both representing binding sites for transcription factors such as NF-{kappa}B (12–15). A series of recent reports has provided evidence that the COX-2 promoter also contains binding sites for the nuclear factor of activated T cells (NFAT) (16–19) and that activation of this factor stimulates COX-2 expression in several cell lines (16–19). The activation of NFAT requires calcineurin phosphatase, which in turn is inhibited by immunosuppressants such as Cyclosporine (CsA) (20–22); it is therefore conceivable that immunosuppressive agents could also interfere with the regulated expression of COX-2 in vivo, particularly in the kidney. It is well known that the kidney is vulnerable toward adverse effects of CsA, including decrease of GFR, tubular dysfunction, glomerulosclerosis, and renal interstitial fibrosis (23,24). In view of the involving role of COX-2 for normal kidney function (25) and the demonstration of NFAT binding sites on its promotor, it appeared of interest to us to determine the effects of calcineurin inhibitors on renal COX-2 expression as well as on the presumably COX-2–dependent regulation of renin synthesis and renin secretion (25).

Using the calcineurin inhibitors CsA and tacrolimus, we found that both drugs selectively suppressed renal COX-2 expression without attenuating the regulation of the renin system.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
CsA was purchased from Sigma (Deisenhofen, Germany). Tacrolimus was a gift from Fujisawa (Munich, Germany), and ramipril was from AstraZeneca (Mölndal, Sweden).

Animals
Male Wistar-Kyoto (WKY) rats (Charles River, Sulzfeld, Germany), initially 7 wk of age, were given vehicle, CsA (15 mg/kg body wt per day) or tacrolimus (5 mg/kg body wt per day) orally by a stomach tube and fed a normal-salt diet (0.6% NaCl, wt/wt; Altromin, Lage, Germany) for 1 wk. The dosage of the drugs has been chosen in accordance with previous studies in which acute nephrotoxicity of these drugs has been studied in rats (26–29). Additional groups of animals were treated with vehicle or CsA and received in addition either a low-salt diet (0.02% NaCl, wt/wt; Ssniff special diets, Soest, Germany) or a low-salt diet in combination with ramipril (10 mg/kg body wt per day) in the drinking water for 7 d. Body weight was monitored daily before drug administration. Rats were divided into groups consisting of eight rats and were killed by decapitation during anesthesia with sevoflurane (3% vol/vol). Blood was collected into EDTA tubes. The kidneys were quickly removed and were dissected into cortex, outer medulla, and inner medulla with a scalpel blade under a stereomicroscope, frozen in liquid nitrogen, and stored at -80°C until extraction of total RNA (30).

Ribonuclease Protection Assays for {beta}-Actin, Renin, COX-1, and COX-2
{beta}-Actin, renin, COX-1, and COX-2 mRNA levels were measured by specific RNase protection assays as described (8). In brief, cRNA probes (5 x 105 cpm) were hybridized at 60°C overnight with 50 µg of total RNA (COX-1 and COX-2), 20 µg of total RNA (renin), 1 µg of total RNA ({beta}-actin), and 20 µg of t-RNA (negative control). They were then digested with RNase A/T1 (RT/30 min) and proteinase K (37°C/30 min). After phenol/chloroform extraction and ethanol precipitation, protected fragments were separated on 8% polyacrylamide gel. The gel was dried for 2 h, and bands were quantitated in a Phosphoimager (Instant Imager 2024, Packard). Autoradiography was performed at -80°C for 1 to 3 d.

Real-Time PCR Analysis of TGF-{beta}1 mRNA
Total RNA of cortex and outer and inner medulla samples were reverse transcribed into cDNA (20 µl) according to standard protocols. In brief, cDNA probes were synthesized in a 20-µl reaction with 2 µg of total RNA, 0.5 µg of oligo(dT)12–18, 20 U of RNasin (Promega, Madison, WI), 4 µl of 5x RT Buffer, 0.5 mM dNTP, and 20 U of M-MLV reverse transcriptase enzyme (Life Technologies, Gaithersburg, MD).

Real-time PCR was performed in a Light Cycler (Roche, Mannheim, Germany). All PCR experiments were done using the Light Cycler DNA Master SYBR Green I kit provided by Roche Molecular Biochemicals (Mannheim, Germany). Each reaction (20 µl) contained 2 µl of cDNA, 3.0 mM MgCl2, 1 pmol of each primer (TGF-{beta}1 upstream primer: cgggatccatcgacatggagctggtga, downstream primer: ggaattcttgtcatagattgcgttg), and 2 µl of Fast Starter Mix (containing buffer, dNTPs, Sybr Green dye, and Taq polymerase). The amplification program consisted of 1 cycle of 95° with 10-min hold (hot start) followed by 40 cycles of 15 s at 95°C, 5 s at 60°C, and 20 s at 72°C. Amplification was followed by melting curve analysis to verify the correctness of the amplicon. A negative control with water instead of cDNA was run with every PCR to assess specificity of the reaction. To verify the accuracy of the amplification, PCR products were further analyzed on ethidium bromide–stained 2% agarose gel. Analyses of data were performed using Light Cycler software version 3.5.3. Standard curves for TGF-{beta}1 and {beta}-actin were generated by using cDNA of rat cortex as template, which was diluted 1:5, 1:10, 1:50, 1:100, and 1:1000. For each sample, the ratio of the amount of TGF-{beta}1 mRNA to that of the {beta}-actin mRNA was calculated.

Determination of Plasma Renin Activity (PRA) and of Renocortical PGE2 Concentration
PRA was determined with a commercially available RIA (Sorin Biomedica, Düsseldorf, Germany). Concentration of tissue PGE2 was assayed by using a monoclonal EIA kit (Cayman Chemical, Ann Arbor, MI). In brief, tissues were homogenized with 10-fold ice-cold isotonic NaCl solution and centrifuged at 10000 x g for 10 min. The supernatant was used for the determination of PGE2 and for the determination of protein according to the method of Lowry.

Immunoblotting for COX-1 and COX-2 Protein
Ten micrograms for inner medulla and 100 µg for outer medulla and renal cortex of total protein were loaded per lane, separated by an 8% SDS-polyacrylamide gel and transferred onto a nitrocellulose membrane (Bio-Rad, Hercules, CA). Membranes were blocked overnight at 4°C and incubated for 2 h at room temperature with the primary antibody (COX-2 murine polyclonal AB [1:500], Cayman Chemicals; COX-1 murine polyclonal AB [1:500], Cayman Chemicals) and a horseradish peroxidase-labeled secondary antibody (goat anti-rabbit IgG [1:500], Santa Cruz Biotechnology, Ann Arbor, MI). Detection was achieved by enhanced chemiluminescence (Amersham). The band intensities were quantified densitometrically.

COX-2 Immunoreactivity
COX-2 immunoreactivity was demonstrated as described previously (31). In brief, sections were layered with the primary antibody (dilution, 1:500; M19; Santa Cruz Biotechnology) and incubated at 4°C overnight. After addition of the second antibody (dilution, 1:500; biotin-conjugated, rabbit anti-goat IgG), the sections were incubated with streptavidin D horseradish peroxidase complex (Vectastain DAB kit; Vector Laboratory, Burlingame, CA) and exposed to 0.1% diaminobenzidine tetrahydrochloride and 0.02% H2O2 as source of peroxidase substrate. Each slide was counterstained with hematoxylin-eosin. As a negative control, we used the same dilutions of preimmune goat serum (for the primary antibody) or normal rabbit IgG (for the second antibody).

Renin Immunoreactivity
For renin immunoreactivity, sections were layered with the primary antibody (dilution, 1:500; gift from Dr. C. Wagner, University of Regensburg, Regensburg, Germany) and incubated at 4°C overnight. After addition of the second antibody (dilution, 1:500; biotin-conjugated, chicken anti-goat IgG, ICN Pharmaceuticals, Frankfurt, Germany), the sections were incubated with avidin D horseradish peroxidase complex (Vectastain DAB kit; Vector Laboratory) and exposed to 0.1% diaminobenzidine tetrahydrochloride and 0.02% H2O2 as source of peroxidase substrate. Each slide was counterstained with hematoxylin-eosin

Statistical Analyses
All values are presented as mean ± SEM. ANOVA and Bonferroni t tests were used for statistical analyses, and differences were considered significant when P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of CsA and Tacrolimus on COX Isoform Expression during Normal Salt Intake
Rats with normal salt intake were treated with vehicle, CsA (15 mg/kg per day) or tacrolimus (5 mg/kg per day) for 7 d, and the effects on the expression of COX-1 and COX-2 in the kidney were determined. Both COX-1 (Figure 1A) and COX-2 (Figure 1B) mRNA levels showed a clear gradient from the renal cortex to the inner medulla with ratios for COX-1 of 1:2.4:15.7 and for COX-2 of 1:2.2:4.6, respectively, in vehicle-treated animals. The ratio of COX-2 to COX-1 mRNA in these animals was 0.5, 0.5, and 0.2 for the renal cortex, outer medulla, and inner medulla, respectively. Basal COX-1 mRNA was not influenced by CsA or by tacrolimus in the rat renal cortex, the outer medulla, and the inner medulla (Figure 1A). In contrast, the levels of basal COX-2 mRNA of animals receiving either CsA or tacrolimus were markedly reduced (P < 0.05) in the renal cortex (to 15% and 12% of values found in vehicle-treated rats), in the outer medulla (to 14% and 9%), and in the inner medulla (to 8% and 7%) (Figure 1A). This decline of COX-2 mRNA abundance was paralleled by a decrease of COX-2 immunoreactive protein (P < 0.05). In animals receiving either CsA or tacrolimus COX-2 protein in the renal cortex fell to 20% and 25% of values found in vehicle-treated rats, to 17% and 14% in the outer medulla, and to 10% and 8% in the inner medulla (Figure 1C).



View larger version (32K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 1. Influence of cyclosporine A (CsA) and tacrolimus on basal renal cyclooxygenase-1 (COX-1) and COX-2 gene expression. COX-1 mRNA (A) and COX-2 mRNA (B) abundance was highest in the rat inner medulla followed by outer medulla and renal cortex. CsA or tacrolimus decreased COX-2 mRNA (B) but not COX-1 mRNA (A) in kidney zones. Immunoreactive COX-2 (C) increased from renal cortex to outer and inner medulla. CsA or tacrolimus treatment decreased immunoreactive COX-2 (C) in all kidney zones. Zonal prostaglandin E2 (PGE2) formation (D) was highest in the rat inner medulla and was decreased by CsA or tacrolimus in all kidney zones (mean ± SEM; n = 8). Inset shows representative blots. *P < 0.05 compared with control.

 
Similarly, renal tissue PGE2 levels fell (P < 0.05) in animals receiving either CsA or tacrolimus to 60% and 55% of vehicle controls in the cortex, to 68% and 65% in the outer medulla, and to 69% and 64% in the inner medulla (Figure 1D). Also COX-2 immunoreactivity in the TALH/macula densa structures decreased as well as in the medullary interstitial cells (Figure 2).



View larger version (168K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 2. Localization of renocortical (A and C) and inner medullar (B and D) ir-COX-2 in control- (A and B) and CsA-treated (C and D) rats. CsA treatment decreased COX-2 immunoreactivity in macula densa as well as in medullar cells. Arrow indicates COX-2 immunoreactivity. Magnifications: x40 in A and C; x100 in B and D.

 
Effect of CsA on Renocortical COX-2 Expression during Low Salt Intake or a Combination of Low Salt Intake and ACE Inhibition
We found similar effects of CsA and tacrolimus on basal COX expression; we therefore used CsA only for subsequent studies in which COX-2 expression was prestimulated. Renocortical COX-1 expression was not influenced by a low-salt diet for 1 wk or by a combination of low-salt diet with ramipril. Additional treatment with CsA did also not affect renocortical COX-1 expression during low salt intake or during low salt intake in combination with ramipril treatment (Figure 3A). In contrast, low-salt diet increased renocortical COX-2 levels 1.8-fold (P < 0.05) (Figure 3B), whereas the combination of low-salt diet with the ACE inhibitor ramipril (10 mg/kg per day) increased COX-2 mRNA levels 6.6-fold (P < 0.05) (Figure 3B). The ratio of COX-2 to COX-1 mRNA in the renal cortex for these rats was 0.9 for the low-salt diet group and 3.5 for rats treated with low-salt diet and ramipril. In rats treated with CsA, COX-2 mRNA levels failed to increase with low-salt diet (P < 0.05) or the combination of low salt intake with ramipril (P < 0.05) (Figure 3B). Low-salt diet led to a small 1.3-fold (P > 0.05) increase, and the combination of low-salt diet with ramipril to a 1.8-fold (P < 0.05) increase in renocortical PGE2 levels. Additional treatment with CsA lowered (P < 0.05) renocortical PGE2 levels to 71% of the respective controls during low salt intake and to 32% (P < 0.05) during the combination of low salt intake and ramipril treatment (Figure 3C).



View larger version (22K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 3. Effect of CsA on COX-2 mRNA abundance during low salt intake or low salt intake combined with ramipril treatment. Low-salt diet or low-salt diet and ramipril treatment did not affect renocortical COX-1 mRNA abundance (A) but increased renal cortical COX-2 mRNA (B) abundance. Additional treatment with CsA abolished the rise in COX-2 mRNA (B) without affecting COX-1 mRNA (A) abundance (mean ± SEM; n = 8). Renocortical PGE2 concentration (C) was decreased by CsA treatment. *P < 0.05 compared with control. {dagger}P < 0.05 compared with normal salt intake. {ddagger}P < 0.05 compared with low salt intake.

 
The data on COX-2 mRNA levels were paralleled by respective changes of COX-2 immunoreactivity in the TALH/macula densa structures (Figure 4). The percentage of glomeruli with adjacent COX-2 immunoreactivity increased from 6% during normal salt intake to about 13% (P < 0.05) during low salt intake and to about 45% (P < 0.05) during low-salt diet in combination with ramipril treatment. Additional treatment with CsA decreased (P < 0.05) the percentage of glomeruli with adjacent COX-2 immunoreactivity to about 2% for all treatment groups (Figure 5A). Renocortical ir-COX-1 protein was not affected by low-salt diet or a combination of low-salt diet with ramipril (Figure 5B) or by additional treatment with CsA. Renocortical ir-COX-2 protein increased to about 130% (P > 0.05) by low salt intake and increased to about 300% (P < 0.05) by low salt intake in combination with ramipril. CsA clearly decreased ir-COX-2 during low salt intake to 27% (P < 0.05) and during low salt intake in combination with ramipril treatment to 10% (P < 0.05) compared with the respective control groups (Figure 5C).



View larger version (170K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 4. Localization of renocortical (A through D) ir-COX-2 expression in low salt (A) or low salt and ramipril (B) treated rats. Additional treatment with CsA (C and D) decreased COX-2 immunoreactivity in macula densa. Magnifications: x40. Arrow indicates COX-2 immunoreactivity.

 


View larger version (20K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 5. Effect of CsA on COX-1 and COX-2 protein expression during low salt intake or low salt intake combined with ramipril treatment. COX-2 immunoreactivity related to macula densa structures (A). CsA treatment decreased irCOX-2 in macula densa of most glomeruli of rats kept on normal-salt diet, on low-salt diet, or on a combination of low-salt diet with the ACE inhibitor ramipril for 7 d. Renocortical ir-COX-1 (B) was not affected by any treatment maneuver. Renocortical ir-COX-2 (C) was decreased by CsA treatment in rats kept on normal-salt diet, on low-salt diet, or on a combination of low-salt diet with the ACE inhibitor ramipril for 7 d. (mean ± SEM; n = 8). *P < 0.05 compared with control; {dagger}P < 0.05 compared with normal salt intake; {ddagger}P < 0.05 compared with low salt intake.

 
Effect of CsA and Tacrolimus on Renin Synthesis, Secretion, and Immunoreactivity
CsA and tacrolimus moderately increased PRA from 6.4 ± 1.0 AngI/h x ml to 11.7 ± 1.9 (P < 0.05) and to 10.8 ± 1.6 (P < 0.05), respectively (Figure 6A). Renin mRNA levels were increased 1.7-fold (P < 0.05) by CsA treatment (Figure 6B) or 1.6-fold (P < 0.05) by tacrolimus treatment under basal conditions. Low-salt diet and low-salt diet in combination with the ACE inhibitor ramipril clearly increased PRA (1.8-fold [P < 0.05] and 7.5-fold [P < 0.05]) and renin mRNA levels (1.8-fold [P < 0.05] and 6.4-fold [P < 0.05]), respectively. The increase in PRA was enhanced by additional CsA treatment to about 200% (P < 0.05) during low salt intake and to about 126% (P > 0.05) during low salt intake in combination with ramipril treatment (Figure 6, A and B). Renin mRNA levels were also enhanced 1.6-fold (P < 0.05) during low salt intake and 1.2-fold (P > 0.05) during low salt intake in combination with ramipril by additional CsA treatment. The changes of renin mRNA levels were paralleled by respective changes of renin immunoreactivity in the juxtaglomerular regions (Figure 7).



View larger version (17K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 6. Influence of CsA on the renin system. Low-salt diet or low-salt diet and ramipril treatment increased plasma renin activity (PRA) (A) and renal renin mRNA abundance (B). PRA and renin mRNA were increased by CsA during normal and low salt intake, but not by low salt intake when combined with ramipril (B) (mean ± SEM; n = 8). *P < 0.05 compared with control; {dagger}P < 0.05 compared with normal salt intake; {ddagger}P < 0.05 compared with low salt intake.

 


View larger version (153K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 7. Localization of renal renin immunoreactivity (A through D) during low salt intake (A) or low-salt diet and ramipril (C) treated rats. Additional treatment with CsA (B and D) increased renin immunoreactivity in macula densa during low salt intake (B) but not during low salt intake when combined with ramipril treatment (D). Magnification: x25.

 
Effect of CsA on TGF-{beta}1 mRNA Levels
TGF-{beta}1 mRNA also showed a clear gradient from the renal cortex to the outer and the inner medulla (1:4.5:10) (Figure 8A). Treatment with CsA for 1 wk resulted in a 1.6-fold (P < 0.05) increase of TGF-{beta}1 mRNA in the rat renal cortex, in a twofold (P < 0.05) increase in the outer medulla, but not in the inner medulla (1.1-fold) (Figure 8A). Low-salt diet alone or the combination of low-salt diet with ramipril did not influence renocortical TGF-{beta}1 mRNA levels (Figure 8B). Additional CsA treatment enhanced renocortical TGF-{beta}1 mRNA 1.7-fold (P < 0.05) during low salt intake, but it failed to increase of TGF-{beta}1 mRNA if low-salt diet was combined with ramipril treatment.



View larger version (17K):
[in this window]
[in a new window]
[as a PowerPoint slide]
  		Figure 8. Influence of CsA on basal renal TGF-{beta}1 mRNA levels. TGF-{beta}1 mRNA levels were highest in the rat inner medulla followed by outer medulla and renal cortex (A). CsA increased TGF-{beta}1 mRNA in the renal cortex and the outer medulla but not in the inner medulla (A). Low-salt diet or low-salt diet in combination with ramipril treatment did not affect renocortical TGF-{beta}1 mRNA levels (B). TGF-{beta}1 mRNA levels were increased by CsA during normal and low salt intake, but not by low salt intake when combined with ramipril (B) (means ± SEM; n = 8) in the rat renal cortex. *P < 0.05 compared with control.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The data obtained in this study clearly demonstrate that calcineurin inhibitors not only decrease basal COX-2 gene expression in the renal cortex and medulla of rats but also attenuate the well-established noninflammatory induction of renocortical COX-2 expression, particularly in the TALH/macula densa structures, by low-salt diet or AngII antagonists (2,7,8). Inhibition of COX-2 gene expression was associated by a decline of COX-2 protein expression as well as by a fall of tissue PGE2 levels. Moreover, this effect of calcineurin inhibitors was specific for COX-2, because the expression of COX-1 was not affected.

Due to their action on calcineurin phosphatase, CsA and tacrolimus are well-characterized inhibitors of the NFAT signaling pathway (32). This signaling pathway has previously been reported to be of major importance for the regulation of COX-2 gene expression in vitro (16–19). Although our in vivo data cannot prove such in vitro data, they are in excellent congruence with them. One may speculate therefrom that the NFAT-pathway could be also of major importance for the expression of COX-2 in the kidney. An inhibition of COX-2 expression and consequently an inhibition of prostanoid formation by calcineurin inhibitors also fits well with in vitro and in vivo data. In this context, it has been found that CsA decreases PGE2 formation in cultures of vascular smooth muscle cells (33) and that calcineurin inhibitors decrease the renal excretion of vasodilatory prostanoids, like PGE2 and prostacyclin, in rats and humans (34,35).

COX-2–derived prostanoids are of importance for renal blood flow and salt excretion (5,25); it is therefore conceivable that the inhibition of COX-2 expression contributes to the well-known adverse effects of calcineurin inhibitors (23,24). The precise mechanism of CsA-induced nephrotoxicity is not well understood, but it has been mainly attributed to afferent arteriolar vasoconstriction leading to an alteration of renal hemodynamics (36). Several vasoactive mediators have been suggested to be involved in this vasoconstriction, including activation of the sympathetic nervous system (37) and the renin system (38), but also a decreased formation of vasodilatory agents like nitric oxide (36,37). However, it has been suggested that the imbalance of vasodilator to vasoconstrictor prostanoids is partially involved in afferent arteriolar vasoconstriction (36). In line, additional treatment with prostanoid-analogous has been shown to prevent at least in part acute CsA-induced nephrotoxicity (39–41). A comparison of the renal effects of selective COX-2 inhibitors with the renal effects of immunosuppressants, in fact, reveals a number of similarities. Both groups of drugs cause vasoconstriction of afferent arterioles, reduce GFR, and cause potassium retention and sodium retention (23,24,42–44). All together, it does not appear far-fetched to attribute those yet-unexplained renal effects of calcineurin inhibitors to the suppression of COX-2–derived PGE2 formation.

It is thought that TGF-{beta}1 mediates part of the renal adverse effects of calcineurin inhibitors, such as the development of interstitial fibrosis (36). In accordance with previous reports (26–29), we found that CsA increased TGF-{beta}1 gene expression and that this stimulation was abrogated by an ACE inhibitor (29). CsA suppressed COX-2 expression both in the absence and in the presence of an ACE inhibitor; TGF-{beta}1 is therefore unlikely to mediate this particular renal effect of CsA. Because PGE2 exerts antifibrotic effects, inhibition of PGE2 by CsA may in turn additionally enhance TGF-{beta}1–induced interstitial fibrosis and chronic calcineurin inhibitor nephrotoxicity, which has been mainly linked to an increased formation of TGF-{beta}1 (36).

The physiologic role of COX-2 expressed in the TaLH, including the macula densa region, is still a matter of debate. Due to the close vicinity of macula densa cells to the renin-producing juxtaglomerular cells, it has been hypothesized that COX-2–derived prostanoids could be involved in the control of renin secretion and renin gene expression (25). This concept has been supported by data obtained from experiments with certain COX-2 blockers (7,45,46) and with COX-2 knockout mice (47,48). However, conflicting data have also been recently reported, raising some doubts on this concept, because commonly available COX-2 blockers do not consistently influence the control of renin synthesis and secretion (31,44,49).

Our data now show that in the absence of calcineurin inhibitors low-salt diet and a combination of low-salt diet with an ACE inhibitor increase renin secretion as well as renin- and COX-2 mRNA expression in parallel, which is in accordance with previous studies (7,8,25). In the presence of CsA, low-salt diet and the combination of low-salt diet and ACE inhibitor stimulates renin secretion and renin expression, whereas COX-2 expression remains blunted. Calcineurin inhibitors even moderately enhanced renin secretion and renin gene expression in rats during normal or low salt intake, which has already been reported by others (38,50).

We infer from these data that the stimulation of renin secretion and of renin gene expression by low salt intake or by a combination of low-salt diet with ACE inhibition are not causally linked to an increased COX-2 expression and probably not linked to COX activity at all. Thus, our data would support those studies that failed to demonstrate an effect of selective COX-2 blockers on the control of renin secretion and renin expression.

In conclusion, our findings provide evidence that calcineurin inhibitors markedly suppress renal COX-2 expression and COX-2–dependent prostanoid formation. This effect may contribute to the adverse renal effects of such drugs. Furthermore, we conclude from our findings, that low-salt diet or AngII-mediated stimulation of the renin system is not causally mediated by a stimulation of macula densa COX-2 activity.


   Acknowledgments
 
The expert technical assistance provided by Anna M‘Bangui and Gertraud Wilberg is gratefully acknowledged. This study was supported by a grant from the Deutsche Forschungsgemeinschaft (Ku 859/13-1).


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Smith WL, DeWitt DL, Garavito RM: Cyclooxygenases: Structural, cellular, and molecular biology. Annu Rev Biochem 69: 145–182, 2000[CrossRef][Medline]
  2. Harris RC, McKanna JA, Akai Y, Jacobson HR, Dubois RN, Breyer MD: Cyclooxygenase-2 is associated with the macula densa of rat kidney and increases with salt restriction. J Clin Invest 94: 2504–2510, 1994
  3. Vio CP, Cespedes C, Gallardo P, Masferrer JL: Renal identification of cyclooxygenase-2 in a subset of thick ascending limb cells. Hypertension 30: 687–692, 1997[Abstract/Free Full Text]
  4. Hackenthal E, Paul M, Ganten D, Taugner R: Morphology, physiology, and molecular biology of renin secretion. Physiol Rev 70: 1067–1116, 1990[Free Full Text]
  5. Schnermann J: Juxtaglomerular cell complex in the regulation of renal salt excretion. Am J Physiol 274: R263–R279, 1998
  6. Hartner A, Goppelt-Struebe M, Hilgers KF: Coordinate expression of cyclooxygenase-2 and renin in the rat kidney in renovascular hypertension. Hypertension 31: 201–205, 1998[Abstract/Free Full Text]
  7. Cheng HF, Wang JL, Zhang MZ, Miyazaki Y, Ichikawa I, McKanna JA, Harris RC: Angiotensin II attenuates renal cortical cyclooxygenase-2 expression. J Clin Invest 103: 953–961, 1999[Medline]
  8. Wolf K, Castrop H, Hartner A, Goppelt-Strube M, Hilgers KF, Kurtz A: Inhibition of the renin-angiotensin system upregulates cyclooxygenase-2 expression in the macula densa. Hypertension 34: 503–507, 1999[Abstract/Free Full Text]
  9. Hao CM, Yull F, Blackwell T, Komhoff M, Bavis LS, Breyer MD: Dehydration activates an NF-kappaB-driven, COX-2 dependent survival mechanism in renal medullary interstitial cells. J Clin Invest 106: 973–982, 2000[Medline]
  10. Cheng HF, Wang JL, Zhang MZ, McKanna JA, Harris RC: Role of p38 in the regulation of renal cortical cyclooxygenase-2 expression by extracellular chloride. J Clin Invest 106: 681–688, 2000[Medline]
  11. Yang T, Huang Y, Heasley LE, Berl T, Schnermann JB, Briggs JP: MAPK mediation of hypertonicity-stimulated cyclooxygenase-2 expression in renal medullary collecting duct cells. J Biol Chem 275: 23281–23286, 2000[Abstract/Free Full Text]
  12. Inoue H, Yokoyama C, Hara S, Tone Y, Tanabe T: Transcriptional regulation of human prostaglandin-endoperoxide synthase-2 gene by lipopolysaccharide and phorbol ester in vascular endothelial cells. Involvement of both nuclear factor for interleukin-6 expression site and cAMP response element. J Biol Chem 270: 24965–24971, 1995[Abstract/Free Full Text]
  13. Morris JC, Ping-Sheng L, Zhai HX, Shen TY, Mensa-Wilmot K: Phosphatidylinositol phospholipase C is activated allosterically by the aminoglycoside G418. 2-deoxy-2-fluoro-scyllo-inositol-1-O-dodecylphosphonate and its analogs inhibit glycosylphosphatidylinositol phospholipase C. J Biol Chem 271: 15468–15477, 1996[Abstract/Free Full Text]
  14. Xie W, Fletcher BS, Andersen RD, Herschman HR: v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element. Mol Cell Biol 14: 6531–6539, 1994[Abstract/Free Full Text]
  15. Yamamoto K, Arakawa T, Ueda N, Yamamoto S: Transcriptional roles of nuclear factor B and nuclear factor-interleukin-6 in the tumor necrosis factor -dependent induction of cyclooxygenase-2 in MC3T3-E1 cells. J Biol Chem 270: 31315–31320, 1995[Abstract/Free Full Text]
  16. Hernandez GL, Volpert OV, Iniguez MA, Lorenzo E, Martinez-Martinez S, Grau R, Fresno M, Redondo JM: Selective inhibition of vascular endothelial growth factor-mediated angiogenesis by Cyclosporine A: Roles of the nuclear factor of activated T cells and cyclooxygenase 2. J Exp Med 193: 607–620, 2001[Abstract/Free Full Text]
  17. de Gregorio R, Iniguez MA, Fresno M, Alemany S: Cot kinase induces cyclooxygenase-2 expression in T cells through activation of the nuclear factor of activated T cells. J Biol Chem 276: 27003–27009, 2001[Abstract/Free Full Text]
  18. Iniguez MA, Martinez-Martinez S, Punzon C, Redondo JM, Fresno M: An essential role of the nuclear factor of activated T cells in the regulation of the expression of the cyclooxygenase-2 gene in human T lymphocytes. J Biol Chem 275: 23627–23635, 2000[Abstract/Free Full Text]
  19. Sugimoto T, Haneda M, Sawano H, Isshiki K, Maeda S, Koya D, Inoki K, Yasuda H, Kashiwagi A, Kikkawa R: Endothelin-1 induces cyclooxygenase-2 expression via nuclear factor of activated T-cell transcription factor in glomerular mesangial cells. J Am Soc Nephrol 12: 1359–1368, 2001[Abstract/Free Full Text]
  20. Schreiber SL, Crabtree GR: The mechanism of action of Cyclosporine A and FK506. Immunol Today 13: 136–142, 1992[CrossRef][Medline]
  21. O’Keefe SJ, Tamura J, Kincaid RL, Tocci MJ, O’Neill EA: TACROLIMUS- and CsA-sensitive activation of the interleukin-2 promoter by calcineurin. Nature 357: 692–694, 1992[CrossRef][Medline]
  22. Crabtree GR: Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NF-AT. Cell 96: 611–614, 1999[CrossRef][Medline]
  23. Myers BD, Ross J, Newton L, Luetscher J, Perlroth M: Cyclosporine-associated chronic nephropathy. N Engl J Med 311: 699–705, 1984[Abstract]
  24. Olyaei AJ, de Mattos AM, Bennett WM: Immunosuppressant-induced nephropathy: pathophysiology, incidence and management. Drug Saf 21: 471–488, 1999[CrossRef][Medline]
  25. Harris RC: Cyclooxygenase-2 in the kidney. J Am Soc Nephrol 11: 2387–2394, 2000[Free Full Text]
  26. Andoh TF, Burdmann EA, Fransechini N, Houghton DC, Bennett WM: Comparison of acute rapamycin nephrotoxicity with cyclosporine and FK506. Kidney Int 50: 1110–1117, 1996[Medline]
  27. Shihab FS, Andoh TF, Tanner AM, Bennett WM: Sodium depletion enhances fibrosis and the expression of TGF-beta1 and matrix proteins in experimental chronic cyclosporine nephropathy. Am J Kidney Dis 30: 71–81, 1997[Medline]
  28. Shihab FS, Andoh TF, Tanner AM, Noble NA, Border WA, Franceschini N, Bennett WM: Role of transforming growth factor-beta 1 in experimental chronic cyclosporine nephropathy. Kidney Int 49: 1141–1151, 1996[Medline]
  29. Shihab FS, Bennett WM, Tanner AM, Andoh TF: Angiotensin II blockade decreases TGF-beta1 and matrix proteins in cyclosporine nephropathy. Kidney Int 52: 660–673, 1997[Medline]
  30. Chomczynski P, Sacchi N: Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987[Medline]
  31. Mann B, Hartner A, Jensen BL, Hilgers KF, Höcherl K, Krämer BK, Kurtz A: Acute upregulation of COX-2 by renal artery stenosis. Am J Physiol Renal Physiol 280: F119–F125, 2001[Abstract/Free Full Text]
  32. Flanagan WM, Corthesy B, Bram RJ, Crabtree GR: Nuclear association of a T-cell transcription factor blocked by tacrolimus and Cyclosporine A Nature 352: 803–807, 1991[CrossRef][Medline]
  33. Kurtz A, Pfeilschifter J, Kuhn K, Koch KM: Cyclosporin A inhibits PGE2 release from vascular smooth muscle cells. Biochem Biophys Res Commun 147: 542–549, 1987[CrossRef][Medline]
  34. Darlametsos IE, Varonos DD: Role of prostanoids and endothelins in the prevention of cyclosporine-induced nephrotoxicity. Prostaglandins Leukot Essent Fatty Acids 64: 231–239, 2001[CrossRef][Medline]
  35. Gossmann J, Radounikli A, Bernemann A, Schellinski O, Raab HP, Bickeboller R, Scheuermann EH: Pathophysiology of cyclosporine-induced nephrotoxicity in humans: A role for nitric oxide? Kidney Blood Press Res 24: 111–115, 2001[CrossRef][Medline]
  36. Olyaei AJ, de Mattos AM, Bennett WM: Nephrotoxicity of immunosuppressive drugs: New insight and preventive strategies. Curr Opin Crit Care 7: 384–389, 2001[CrossRef][Medline]
  37. Ader JL, Rostaing L: Cyclosporin nephrotoxicity: Pathophysiology and comparison with FK-506. Curr Opin Nephrol Hypertens 7: 539–545, 1998[Medline]
  38. Lee DB: Cyclosporine and the renin-angiotensin axis. Kidney Int 52: 248–260, 1997[Medline]
  39. Ryffel B, Donatsch P, Hiestand P, Mihatsch MJ: PGE2 reduces nephrotoxicity and immunosuppression of cyclosporine in rats. Clin Nephrol 25: S95–S99, 1986
  40. Moran M, Mozes MF, Maddux MS, Veremis S, Bartkus C, Ketel B, Pollak R, Wallemark C, Jonasson O: Prevention of acute graft rejection by the prostaglandin E1 analogue misoprostol in renal-transplant recipients treated with cyclosporine and prednisone. N Engl J Med 322: 1183–1188, 1990[Abstract]
  41. Nast CC, Hirschberg R, Artishevsky A, Adler SG: Misoprostol partially inhibits the renal scarring of chronic cyclosporine nephrotoxicity. Am J Ther 2: 882–885, 1995[Medline]
  42. Komers R, Anderson S, Epstein M: Renal and cardiovascular effects of selective cyclooxygenase-2 inhibitors. Am J Kidney Dis 38: 1145–1157, 2001[Medline]
  43. Ichihara A, Imig JD, Navar LG: Cyclooxygenase-2 modulates afferent arteriolar responses to increases in pressure. Hypertension 34: 843–847, 1999[Abstract/Free Full Text]
  44. Rossat J, Maillard M, Nussberger J, Brunner HR, Burnier M: Renal effects of selective cyclooxygenase-2 inhibition in normotensive salt-depleted subjects. Clin Pharmacol Ther 66: 76–84, 1999[CrossRef][Medline]
  45. Harding P, Carretero OA, Beierwaltes WH: Chronic cyclooxygenase-2 inhibition blunts low sodium-stimulated renin without changing renal haemodynamics. J Hypertens 18: 1107–1113, 2000[CrossRef][Medline]
  46. Traynor TR, Smart A, Briggs JP, Schnermann J: Inhibition of macula densa-stimulated renin secretion by pharmacological blockade of cyclooxygenase-2. Am J Physiol 277: F706–F710, 1999
  47. Cheng HF, Wang JL, Zhang MZ, Wang SW, McKanna JA, Harris RC: Genetic deletion of COX-2 prevents increased renin expression in response to ACE inhibition. Am J Physiol Renal Physiol 280: F449–F456, 2001[Abstract/Free Full Text]
  48. Yang T, Endo Y, Huang YG, Smart A, Briggs JP, Schnermann J: Renin expression in COX-2-knockout mice on normal or low-salt diets. Am J Physiol Renal Physiol 279: F819–F825, 2000[Abstract/Free Full Text]
  49. Rodriguez F, Llinas MT, Gonzalez JD, Rivera J, Salazar FJ: Renal changes induced by a cyclooxygenase-2 inhibitor during normal and low sodium intake. Hypertension 36: 276–281, 2000[Abstract/Free Full Text]
  50. Yang CW, Ahn HJ, Kim WY, Shin MJ, Kim SK, Park JH, Kim YO, Kim YS, Kim J, Bang BK: Influence of the renin-angiotensin system on epidermal growth factor expression in normal and cyclosporine-treated rat kidney. Kidney Int 60: 847–857; 2001[CrossRef][Medline]
Received for publication April 16, 2002. Accepted for publication July 9, 2002.




This article has been cited by other articles:


Home page
 Am. J. Physiol. Renal Physiol.Home page
H. I. Abdullah, P. L. Pedraza, J. C. McGiff, and N. R. Ferreri
Calcium-sensing receptor signaling pathways in medullary thick ascending limb cells mediate COX-2-derived PGE2 production: functional significance
Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1082 - F1089.
[Abstract] [Full Text] [PDF]

Home page
 Br. J. Ophthalmol.Home page
R Cruz, J D Quintana-Hau, J R Gonzalez, R Tornero-Montano, L M Baiza-Duran, and L Vega
Effects of an ophthalmic formulation of meloxicam on COX-2 expression, PGE2 release, and cytokine expression in a model of acute ocular inflammation
Br. J. Ophthalmol., January 1, 2008; 92(1): 120 - 125.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
H. Liu, W. Ye, G. Guan, Z. Dong, Z. Jia, and T. Yang
Developmental regulation of calcineurin isoforms in the rodent kidney: association with COX-2
Am J Physiol Renal Physiol, December 1, 2007; 293(6): F1898 - F1904.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
A. Doller, E.-S. Akool, R. Muller, P. Gutwein, C. Kurowski, J. Pfeilschifter, and W. Eberhardt
Molecular Mechanisms of Cyclosporin A Inhibition of the Cytokine-Induced Matrix Metalloproteinase-9 in Glomerular Mesangial Cells
J. Am. Soc. Nephrol., February 1, 2007; 18(2): 581 - 592.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
J. M. Perez-Rojas, S. Derive, J. A. Blanco, C. Cruz, L. M. de la Maza, G. Gamba, and N. A. Bobadilla
Renocortical mRNA expression of vasoactive factors during spironolactone protective effect in chronic cyclosporine nephrotoxicity
Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1020 - F1030.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Höcherl, K.
Right arrow Articles by Kurtz, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Höcherl, K.
Right arrow Articles by Kurtz, A.

HOME CURRENT ISSUE ARCHIVES JASN Express ONLINE SUBMISSION AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP