 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
Department of Medicine, Monash University Medical School, Alfred Hospital, Prahran, Victoria, Australia.
Correspondence to Dr. Alicia Noemi Stein-Oakley, Department of Medicine, Monash University Medical School, Alfred Hospital, Prahran, Victoria 3181, Australia. Phone: 61-3-9903-0539; Fax: 61-3-9521-2124; E-mail: alicia.stein-oakley{at}med.Monash.edu.au
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Apoptosis, a process of intrinsically programmed cell suicide, is characterized morphologically and biochemically by nuclear shrinkage, chromatin condensation, condensation of cytoplasmic matrix and organelles, cytoplasmic blebbing, and internucleosomal DNA fragmentation. Apoptosis can be triggered by a variety of stimuli, including physiologic and pathologic factors, that activate one of several signaling pathways (3). The Fas ligand/Fas pathway is one of best-characterized apoptotic signaling pathways. Fas (CD95, Apo-1) is a member of the tumor necrosis factor receptor family (4,5). Fas has a death domain in its cytoplasmic tail, which can associate via various combinations of adaptors with the death effector domain present in the N-terminal prodomains of caspases 8 and 10. Once activated, these caspases translocate to the cytoplasm, where they can activate downstream caspases, e.g., caspase 3 (6).
The Bcl-2 family is defined as proteins that share one or more of four conserved domains, BH1, BH2, BH3, and BH4 (7). The Bcl-2 family includes survival (e.g., Bcl-2, Bcl-xL) and proapoptotic factors (e.g., Bax, Bad, and Bid). Cytosolic Bax can translocate to the mitochondrial membrane, and its dimerization is associated with mitochondrial dysfunction and cell death. Bcl-2 is tethered to the outer mitochondrial membrane and may prevent the release of cytochrome c from mitochondria (8). Cytochrome c in conjunction with ATP induces a conformational change in apoptotic protease activating factor 1, leading to activation of caspase-9, which in turn activates downstream caspases (9).
Renal lesions that are similar histologically to human FSGS can be induced in rats through administration of PAN, a nephrotoxic antibiotic. The PAN model used in this study is based on a dual dose of PAN combined with uninephrectomy (10). The model closely resembles human FSGS disease and is characterized clinically by progressive renal dysfunction and proteinuria, and pathologically by progressive FSGS, tubular dilation followed by tubular atrophy, and interstitial fibrosis. The present study was designed to determine whether apoptosis is involved in the pathophysiologic changes seen within this model and the roles of the signaling and regulatory molecules Fas, Fas ligand, Bax, and Bcl-2.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Isolation of Glomeruli
A sample of cortex was cut into 1- to 2-mm3 blocks and passed
sequentially through 80-, 100-, and 200-mesh wires with the use of
diethylpyrocarbonate-treated phosphate-buffered saline (PBS). Glomeruli were
collected from the surface of the 200-mesh wire. Glomerular samples were
centrifuged at 750 x g for 10 min, and the pellet was
resuspended in either 1.5 ml of 5 M GTC or 700 ml of RNeasy lysis buffer
(Qiagen Inc., Chatsworth, CA) before being transferred into a 2-ml freezing
vial and stored at -80°C until RNA was extracted.
Histologic Analysis
Sections of the formalin-fixed, paraffin-embedded tissues were stained with
periodic acid-Schiff and silver Masson trichrome to assess glomerular and
tubulointerstitial damage by light microscopy. Glomerular tuft size was
determined by measurement of the area of 20 to 30 glomeruli sectioned through
the vascular pole, with the use of an image analysis system with Image Pro
Plus (Media Cybernetics, Silver Spring, MD). Glomerular sclerotic changes were
graded in 50 to 100 randomly selected glomeruli per tissue section, with the
use of a severity score: grade 1, increased mesangial material involving up to
one fourth of the glomerular tuft; grade 2, involving one fourth to one half
the glomerular tuft; grade 3, involving one half to three fourths of the
glomerular tuft; or grade 4, involving three fourths to a whole of the
glomerular tuft. A GS score for each tissue was given as the product of the
percentage of glomeruli affected by the severity score, the maximum GS score
being 400. Glomerular cells in each sample were counted in 15 glomeruli
sectioned through the vascular pole. For assessment of tubular damage, 20
random fields of renal cortex (equivalent to an area of 3 mm2) were
examined at a final magnification of 400x. Tubular dilation, tubular
atrophy, and fibrosis were graded in each field as follows: grade 0,
well-preserved renal architecture; grade 1, less than 25% of the field
involved; grade 2, 25 to 50% of the field involved; grade 3, 50 to 75% of the
field involved; grade 4, 75 to 100% of the field involved. Scores were
recorded for each tissue, with the maximum score being 4.
Terminal Deoxynucleotidyl Transferase Mediated dUTP Nick End
Labeling
Five-µm sections of formalin-fixed, paraffin-embedded renal tissue were
dewaxed, rehydrated, washed in PBS, and incubated in terminal deoxynucleotidyl
transferase (TdT) buffer for 10 min at room temperature before incubation with
TdT enzyme (Promega, Madison, WI) and digoxigenin-labeled dUTP (Boehringer
Mannheim, Mannheim, Germany) for 1 h at 37°C. After the sections were
washed in PBS, a sheep anti-digoxigenin F(ab)2 was applied for 1 h
at room temperature. Endogenous peroxidase was blocked, and a
peroxidase-conjugated rabbit anti-sheep antibody was applied, followed by
peroxidase-conjugated swine anti-rabbit antibody. The reaction was developed
with the use of Pierce metal-enhanced diaminobenzidine substrate (Rockford,
IL). On the basis of terminal deoxynucleotidyl transferase mediated dUTP nick
end labeling (TUNEL) staining
(11) and morphologic changes,
the apoptotic cells were counted under light microscope in 50 glomerular cross
sections and 10 random areas of 0.15 mm2 in the interstitium, with
the use of a grid at 400x magnification. Negative controls without TdT
enzyme and positive controls with DNase treatment were included for each
tissue. No paraffin-embedded tissues of the PAN model were available to assess
apoptosis by TUNEL technique at week 17.
Immunohistochemistry
A four-layer immunoperoxidase technique was applied to detect the
infiltration of monocyte/macrophages, T cells, and interleukin-2 (IL-2)
receptor—positive cells in 4-µm frozen sections, as described
previously (12). Antibodies
used included ED1 (anti-rat monocyte/macrophages, kindly provided by Dr.
Dijkstra, Free University, Amsterdam, The Netherlands)
(13), R73 (anti-rat
/ß T-cell receptor), and NDS61 (anti-CD25) (both from Serotec,
Oxford, England). Proliferating cell nuclear antigen (PCNA) was detected by
four-layer immunohistochemistry on formalin-fixed, paraffin-embedded tissues.
T cells, monocytes/macrophages, and IL-2 receptor—positive cells were
counted in 10 glomerular cross sections and 10 random areas of 0.15
mm2 in interstitial areas, respectively, with the use of a grid at
400x magnification. PCNA-positive cells were counted in 10 to 43
glomerular cross sections, and results are expressed as cells per
glomerulus.
TUNEL/Immunohistochemistry
Combined TUNEL/immunohistochemistry staining was performed to identify the
cells that were undergoing apoptosis in the PAN model. TUNEL was performed as
described above, with the omission of the peroxidase-conjugated swine
anti-rabbit antibody, to prevent cross reactivity. The TUNEL reaction was
developed with diaminobenzidine, resulting in a brown product. Slides were
washed in running tap water, followed by Tris-buffered saline. Preincubation
in 20% normal rabbit serum in Tris-buffered saline for 10 min at room
temperature was followed by overnight incubation with the primary antibody at
4°C. The second layer of rabbit anti-mouse Ig was applied for 30 min
followed by mouse alkaline phosphatase anti-alkaline phosphatase. The reaction
was developed with New Fuchsin, resulting in a red product. Slides then were
counterstained in hematoxylin and mounted.
Competitive Reverse Transcription-PCR
RNA Extraction. Total renal RNA was extracted from 0.1 to 1 g of
renal tissue with the use of guanidine isothiocyanate and caesium chloride
centrifugation (14).
Glomerular RNA was extracted and purified with the use of the RNeasy kit
(Qiagen Inc., Hilden, Germany). RNA concentrations were assessed
spectrophotometrically. Before reverse transcription (RT), the RNA samples
were diluted to 0.5 to 1 µg/µl to avoid variability in transcription
efficiency.
Reverse Transcription. The RT was carried out with the use of the Perkin-Elmer Reverse Transcription System (Perkin Elmer Inc., Norwalk, CT), as per the manufacturer's instructions.
Primer Design. On the basis of the published sequences (15,16,17,18), four primers were designed for each gene with the use of Oligo 5 Software for Windows (National Biosciences Inc., Plymouth, MN), including one upstream primer, two downstream primers, and a composite primer that combined the two downstream primers. The details of primers are shown in Table 1; their positions in the published sequences are shown in parentheses.
|
Competitor Synthesis. Deletion mutants were generated on the basis of the method described by Celi et al. (19). First, native RNA was reverse transcribed into cDNA and amplified with the use of the upstream primer and downstream primer 1 or upstream primer and downstream primer 2 to verify the specificity of the PCR products. When both reactions amplified only one band of the expected product length, the upstream primer and composite primer were used to amplify the native cDNA for generating the competitors, which were purified after electrophoresis (Qiagen DNA gel purification kit), quantified, and stored at -20°C.
Quantitative Analysis of Fas, Fas Ligand, Bax, and Bcl-2 Gene Expression. PCR reactions were set up in a 25-µl volume with the use of a PCR amplification kit with AmpliTaq Gold (Perkin-Elmer). It contained 10 mmol/L Tris, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.2 mmol/L each deoxynucleotide triphosphate, 0.5 µmol/L each primer pair (fluorescein-labeled upstream primer and unlabeled downstream primer 2), 1.25 U AmpliTaq Gold, 2.5 µl of cDNA sample, and 2.5 µl of varying dilutions of the competitor. Thirty µl of mineral oil was added to avoid evaporation. Annealing temperatures were 59°C (Bax and Fas), 60°C (Bcl-2), and 61°C (Fas ligand), and the number of cycles were 40 for Fas and Bax and 50 for Fas ligand and Bcl-2. PCR products were run on a 3% agarose gel and scanned with the use of a fluorimager (FluorImager 575, Molecular Dynamics, Sunnyvale, CA). The log of the competitor copy number was plotted against the log of the ratio cDNA/competitor bands. At least five dilutions of competitor were used per sample. Linear regression analysis was performed to assess the copy number of each gene in the test samples, and the result was expressed as copy number per nanogram of RNA.
In Situ Hybridization for Bax, Bcl-2, and Fas mRNA
For probe generation, primers were designed to incorporate T7 phage RNA
polymerase and SP6 phage RNA polymerase promoters in the 5' ends of the
upper and lower primers respectively. Bax: upper primer,
TAATACGACTCACTATAGGCGAATTGGAGATGAACTGG; lower primer,
ATTTAGGTGACACTATAGACAAAGTAGAAGAGGGCAACC; Bcl-2: upper primer,
TAATACGACTCACTATAGGCGGGAGATCGTGATGAAGTA; lower primer,
ATTTAGGTGACACTATAGAGAAGGGCGTCAGGTGC; Fas: upper primer,
TAATACGACTCACTATAGGGGTTTGGCAATTCTATTTGT; lower primer,
ATTTAGGTGACACTATAGACGGGATCTTGTGCT. For the generation of linear DNA templates
for probes, rat total RNA was reverse transcribed and amplified by PCR as
described above, generating PCR products of 199 bp, 368 bp, and 236 bp for
Bax, Bcl-2, and Fas, respectively. The PCR products were
purified with the use of a PCR product purification kit (Qiagen). Fluorescein
labeled sense and antisense cRNA probes for Bax and Bcl-2
were transcribed with the use of SP6 RNA polymerase and T7 RNA polymerase,
respectively (RNA color kit for nonradioactive in situ hybridization;
Amersham, Uppsala, Sweden). The probes were run on a denaturing agarose gel,
and the size, integrity, and quantity of probes were verified by fluorimager
scanning.
Five-µm paraffin-embedded sections were dewaxed and pretreated with 0.2 M HCl followed by 0.25% protease VIII (Sigma) at 37°C for 6 min, fixed with 4% paraformaldehyde for 15 min at room temperature, and further treated with 0.25% acetic anhydride in 0.1 M triethanolamine (pH 8.0) for 10 min. Sections then were incubated in prehybridization buffer (2 x SSC, 20% deionized formamide, 10 x Denhardt's, 20% Dextran Sulfate, 0.25 mg/ml yeast t-RNA, and 0.5 mg/ml freshly denatured herring sperm DNA) at 50°C for 1.5 to 2 h. Hybridization was performed with the use of a probe concentration of 0.8 µg/ml (Bax) or 0.6 µg/ml (Bcl-2 and Fas) in hybridization buffer (in situ hybridization grade buffer containing 50% deionized formamide; Amersham) at 50°C overnight. After hybridization, sections were washed twice with 1 x SSC/0.1% sodium dodecyl sulfate, followed by two high stringency washes with 0.2 x SSC/0.1% sodium dodecyl sulfate at 50°C. Sections were treated with blocking solution (Amersham) before addition of alkaline-phosphatase—conjugated sheep anti-fluorescein antibody for 1 h. Color was developed with Nitro-blue tetrazolium and 5-bromo-4-chloro-3-indolylphosphate substrate. Sections were counterstained with nuclear fast red and coverslipped with aqueous mount. A sense probe control was included for each sample.
Statistical Analyses
All statistical analyses were performed with the use of SPSS for Windows
(SPSS, Inc., Chicago, IL). Competitive PCR results were log transformed to
attain a normal distribution. After demonstration of significant difference by
ANOVA, group pairs were compared by independent t test. Nonparametric
data were analyzed by Kruskal-Wallis ANOVA by ranks followed by Mann-Whitney
U test for pairwise comparisons.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Histologically, the PAN-treated animals demonstrated glomerular hypertrophy and mild degrees of GS as early as week 3 (Table 2). As disease progressed, the glomerular hypertrophy reached steady-state levels by week 6; the GS became progressively more severe, although it remained focal. Figure 2 depicts a PAN-treated animal at week 17. Two glomeruli are seen, with damage scores of 1 and 4, respectively. PCNA staining demonstrated significantly increased glomerular cell proliferation in the PAN model at day 2 and from weeks 3 to 17 (Table 2), compared with sham rats.
|
|
Progressive tubulointerstitial damage was evident throughout the cortical and medullary regions of the kidney (Table 2). Tubular dilation was seen at day 2, and tubular atrophy and interstitial fibrosis were evident from week 3, their severity increasing with time. Figure 2 demonstrates tubular atrophy and interstitial fibrosis, as well as a focal area of interstitial inflammatory cell infiltrate in the PAN model at week 17.
Apoptosis
Glomerular apoptosis was not a prominent feature in the PAN model; only 18%
of PAN animals demonstrated any glomerular cell apoptosis (between 1 and 4
cells/50 glomeruli). This did not differ significantly from results obtained
in shams, in which apoptotic glomerular cells (1 to 2 cells/50 glomeruli) were
detected in 7% of tissues analyzed (Figure
3A). Glomerular apoptosis was not associated with GS score.
|
Glomerular apoptotic cells can be cleared rapidly by phagocytosis or by detachment into Bowman's capsule and thus may not be detected by the TUNEL method. To investigate further glomerular cell changes in the PAN model, glomerular cellularity was assessed in relation to glomerular damage (Figure 4). Glomerular hypercellularity was evident from week 6 to week 17 in glomeruli with up to 50% sclerosis (grades 0, 1, and 2; P < 0.001). In the PAN model, glomeruli with more than 50% sclerosis (grades 3 and 4) had significantly decreased cellularity compared with grades 0 to 2 (P < 0.001). Nevertheless, glomerular cellularity at weeks 12 and 17 was increased in glomeruli with more than 50% sclerosis as compared with sham controls (P < 0.01)
|
In the tubulointerstitium, significantly increased apoptosis was evident in
the PAN model from week 1, persisting until week 12, whereas very few
apoptotic cells were seen in the sham controls
(Figure 3B). Apoptotic cell
numbers were correlated significantly with the tubulointerstitial damage
scores (Spearman coefficient, 0.62; n = 33; P < 0.01).
Apoptotic cells were identified morphologically and by two-color
TUNEL/immunohistochemistry. Figure
5A depicts a TUNEL-positive cell also staining for ED1
monocyte/macrophage marker (brown and red staining, arrow), whereas
Figure 5B demonstrates an
apoptotic tubular epithelial cell (brown staining), identified
morphologically. Figure 5, C and
D, shows examples of double staining with -smooth muscle
actin, a marker for interstitial myofibroblasts and mesangial cell activation,
as well as for vascular smooth muscle cells. No TUNEL-positive/-smooth
muscle actin-positive cells were identified in the samples examined by
two-color staining. This result was consistent with morphologic assessment of
TUNEL-positive cells in other tissues, which tended to be clearly tubular
epithelial cells or seemed to be within foci of infiltrating leukocytes rather
than in myofibroblast areas. Figure
5C depicts a glomerular apoptotic cell (brown); the red staining
demonstrates mesangial cell activation and periglomerular myofibroblasts.
Figure 5D exhibits an apoptotic
tubular epithelial cell and staining of peritubular myofibroblasts and
vascular smooth muscle cells.
|
Bax, Bcl-2, Fas, and Fas Ligand Expression
Competitive reverse transcription-PCR methods were established for the
quantification of Bax, Bcl-2, Fas, and Fas ligand mRNA.
Figure 6 shows a representative
image. The expression of Bax, Bcl-2, Fas, and Fas ligand in
isolated glomerular RNA is shown in Figure
7. There were no consistent significant trends in the expression
of the genes examined, despite occasional significant differences being
observed between the PAN and sham groups at isolated time points. In contrast,
there was increased expression of Bax, Fas, and Fas ligand
in total renal RNA, consistent with the increased numbers of apoptotic cells
in the tubulointerstitium (Figure
8). In the PAN model, Bax was upregulated at day 2 and
week 1 (P < 0.001 versus sham controls) and returned to
normal by week 3. After the second dose of PAN, Bax was upregulated
from week 6 and persisted until week 17 (P < 0.01 versus
sham controls; Figure 8A).
Bax mRNA was correlated significantly with renal dysfunction and with
the incidence of apoptosis in the tubulointerstitium (Spearman coefficients,
0.74 [n = 45] and 0.71 [n = 38], respectively; P
< 0.01). No significant difference was detected in total renal
Bcl-2 mRNA between the PAN model and sham controls
(Figure 8B). Significantly
increased expression of Fas was demonstrated at day 2 and from week 6
to week 17 in the PAN model (P < 0.05 versus sham
controls; Figure 8C).
Significantly increased expression of Fas ligand was evident from
week 1 in the PAN model (P < 0.05 versus sham controls),
peaking at week 17 (P < 0.01 versus sham controls;
Figure 8D). The mRNA
concentrations of Fas and Fas ligand were correlated
significantly with the incidence of apoptosis in the tubulointerstitium
(Spearman coefficients, 0.49 [n = 30] and 0.84 [n = 34],
respectively; P < 0.001).
|
|
|
In Situ Hybridization
The pattern of expression of Bax detected by in situ
hybridization was consistent with the results of competitive reverse
transcription-PCR. Figure 9A
demonstrates low levels of Bax mRNA on distal tubular epithelial
cells and on few glomerular epithelial cells in a sham animal at week 17.
Bax also was expressed on collecting ducts in sham animals.
Bax mRNA was upregulated in PAN animals at week 17. Bax was
expressed by distal tubular epithelial cells and collecting ducts, being
particularly prominent in dilated tubules
(Figure 9B). Few cells that
were identified morphologically as infiltrating leukocytes had a strong
Bax mRNA signal (Figure
9C). Bax also was expressed by glomerular visceral and
parietal epithelial cells. In sham animals, Bcl-2 mRNA was localized
by in situ hybridization to visceral and parietal epithelial cells in
glomeruli and to tubular epithelial cells
(Figure 9D). Although no
overall upregulation of Bcl-2 was demonstrated, increased expression
was evident segmentally in glomeruli in some PAN animals
(Figure 9E), presumably
expressed by mesangial cells. Few cells within foci of infiltrating leukocytes
also expressed Bcl-2 (Figure
9F). Fas was not detected by in situ
hybridization in the sham animals. In the PAN model, it was detected weakly
from week 3, and a progressively stronger signal was evident from week 6,
expressed on tubular epithelial cells and infiltrating leukocytes. There was
marked variability in expression between tubules and between different cells
within one tubule (Figure 9, G and
H). No signal was detected when sense probes were used
(Figure 9I).
|
Analysis of Infiltrating Leukocyte Subpopulations
Sham controls had normal numbers of T cells and monocytes/macrophages in
both the glomerular and the tubulointerstitial compartments. In contrast,
analysis of infiltrating leukocytes in the PAN model showed progressively
increased numbers of T cells, IL-2 receptor-positive cells, and
monocytes/macrophages in tubulointerstitial areas
(Figure 10). T cells and IL-2
receptor-positive cells in the tubulointerstitium were correlated
significantly with the total renal mRNA levels of Fas ligand
(Spearman coefficient, 0.70 [n = 38; P < 0.01] and 0.73
[n = 38; P < 0.001]). Most glomeruli had no T cells or
IL-2 receptor-positive cells. Most PAN animals had normal ED1-positive cells
in glomeruli (1 to 3/glomerulus), but an increase up to 6 cells/glomerulus was
seen at weeks 6 and 17.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The involvement of apoptosis in the evolution of glomerular pathologic changes in various renal diseases has been demonstrated in a variety of clinical and experimental studies (20,21,22,23). In the present study, glomerular apoptosis was not a prominent feature, and no consistent significant changes in expression of the genes analyzed were observed. All PAN and sham control animals demonstrated Bax and Bcl-2 mRNA on glomerular visceral and parietal epithelial cells, as previously observed by others (24). Segmental increased Bcl-2 expression was evident in some glomeruli. Fas was not detected in glomeruli by in situ hybridization, suggesting a relatively lower level of expression. Shiiki et al. (25) described similar numbers of glomerular apoptotic cells (4/100 glomeruli) and increased Bcl-2 in an FSGS model induced by administration of 10 subcutaneous injections of PAN. However, other studies associated glomerular cell apoptosis with progression of GS in the later stages of the remnant kidney model (22), and glomerular apoptotic cells in IgA nephropathy and lupus nephritis have been shown to correlate with glomerular sclerosis index (22). Analysis of glomerular cell numbers revealed increased cellularity in the PAN model from week 6, consistent with increased cell proliferation and low glomerular cell apoptosis. However, comparison of cell numbers in glomeruli with more or less than 50% sclerosis revealed that a degree of cell deletion occurred, associated with extracellular matrix (ECM) accumulation. Recent studies demonstrated an important role for the ECM in the regulation of survival or death of mesangial cells. Normal glomerular ECM components, such as type IV collagen and laminin, protect mesangial cells from apoptosis induced by serum deprivation or by DNA damage induced by etoposide treatment (26,27). In contrast, collagen type I, fibronectin, and osteopontin/SPARC, ECM components that are overexpressed in diseased glomeruli, failed to promote mesangial cell survival. It therefore is likely that the glomerular cell loss detected in glomeruli with >50% sclerosis is a response to the pathologic changes in ECM composition. The TUNEL method detects apoptosis at a particular point in time, and rapid clearance of apoptotic cells by phagocytosis or detachment into the Bowman's space may result in an underestimation of the importance of this mechanism.
It is generally accepted that tubulointerstitial damage has a better correlation with renal dysfunction than glomerular lesions. Increased apoptosis has been associated with the progression of tubulointerstitial pathologic changes and tubular atrophy in ureteric obstruction (28), cyclosporine nephropathy (29), and diabetic nephropathy (30). The loss of renal tubules and the accumulation of ECM, including collagens, fibronectin, and laminin, characterize the renal tubulointerstitial damage. In this study, many apoptotic cells in the tubulointerstitium were identified morphologically as tubular epithelial cells, demonstrating a contribution of this process to the development of tubular atrophy. Furthermore, there was a close correlation between apoptosis in the tubulointerstitial areas and the tubulointerstitial damage scores in the PAN model.
Fas and Fas ligand mRNA were increased in total renal tissue but not in glomerular tissue, consistent with increased tubulointerstitial apoptosis. Previous studies demonstrated constitutive expression of Fas by leukocytes, and in the kidney by mesangial cells and tubular cells (31,32). In situ hybridization analysis demonstrated Fas mRNA on infiltrating leukocytes and progressively increasing expression on tubular epithelial cells in the PAN model from week 3, associated with severity of injury. Fas ligand is expressed by activated T cells and can be expressed at low level by the tubular epithelial cells in the kidney (16,31). Fas ligand expression was significantly correlated with activated T-cell numbers, suggesting that these were the primary source of Fas ligand mRNA. The interaction of Fas ligand on the activated T cells with Fas expressed on tubular epithelial cells would provide a signal for apoptosis, contributing to the tubular atrophy observed in this model. However, apoptosis was also evident on infiltrating leukocytes, suggesting activation-induced cell death may have contributed to the resolution of the inflammatory injury.
No significant changes in Bcl-2 expression were evident in the tubulointerstitium in the PAN model. Bcl-2 was expressed in PAN and sham animals by proximal and distal tubular cells, the loop of Henle, and papillary collecting ducts, consistent with previous findings (24). Bax and Bak were shown previously to be expressed in tubular cells (33). In sham animals, weak Bax mRNA hybridization signal was apparent in distal tubular epithelial cells and glomerular visceral and parietal epithelial cells. In the PAN model, increased Bax mRNA hybridization signal in the tubulointerstitium was localized to dilated tubules and few infiltrating leukocytes in the PAN model. The close correlation between Bax mRNA levels and the incidence of apoptosis indicated that the upregulation of Bax was associated with the increased incidence of apoptosis. The specific signal for upregulation of Bax in the PAN model is not known. However, increased expression of transforming growth factor ß1 is a characteristic of this model (10). This growth factor has been shown to induce apoptosis in a variety of cell types (34,35,36) and to increase the expression of Bax and downregulate Bcl-2 in a leukemic cell line (37). Thus, the upregulation of transforming growth factor ß1 in PAN nephritis may contribute to the increased apoptosis described in this article.
This study demonstrated increased apoptosis in the tubulointerstitial areas of the dual-dose PAN model of FSGS, strongly associated with the severity of pathologic damage in the tubulointerstitium. The balance between survival and apoptotic factors was found to be altered, and the Fas/Fas ligand signaling pathway was shown to be involved in chronic PAN nephropathy. The apoptotic death of tubular epithelial cells is an important link in the complex chain of events, which eventually results in the replacement of functional renal cells by fibrotic tissue, leading to end-stage renal failure.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  H.-A. Shui, T.-H. Huang, S.-M. Ka, P.-H. Chen, Y.-F. Lin, and A. Chen Urinary proteome and potential biomarkers associated with serial pathogenesis steps of focal segmental glomerulosclerosis Nephrol. Dial. Transplant., January 1, 2008; 23(1): 176 - 185. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Wang, L. Soltero, P. Zhang, X. R. Huang, H. Y. Lan, and H. J. Adrogue Renal inflammation is modulated by potassium in chronic kidney disease: possible role of Smad7 Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1123 - F1130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Hiramatsu, K. Hiromura, T. Shigehara, T. Kuroiwa, H. Ideura, N. Sakurai, S. Takeuchi, M. Tomioka, H. Ikeuchi, Y. Kaneko, et al. Angiotensin II Type 1 Receptor Blockade Inhibits the Development and Progression of HIV-Associated Nephropathy in a Mouse Model J. Am. Soc. Nephrol., February 1, 2007; 18(2): 515 - 527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Wang, X. R. Huang, E. Canlas, K. Oka, L. D. Truong, C. Deng, N. A. Bhowmick, W. Ju, E. P. Bottinger, and H. Y. Lan Essential Role of Smad3 in Angiotensin II-Induced Vascular Fibrosis Circ. Res., April 28, 2006; 98(8): 1032 - 1039. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. E. Godler, A. N. Stein, O. Bakharevski, M. M. L. Lindsay, and P. F. J. Ryan Parathyroid hormone-related peptide expression in rat collagen-induced arthritis Rheumatology, September 1, 2005; 44(9): 1122 - 1131. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Wang, X. R. Huang, A. G. Li, F. Liu, J.-H. Li, L. D. Truong, X. J. Wang, and H. Y. Lan Signaling Mechanism of TGF-{beta}1 in Prevention of Renal Inflammation: Role of Smad7 J. Am. Soc. Nephrol., May 1, 2005; 16(5): 1371 - 1383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-y. Kaimori, M. Takenaka, H. Nakajima, T. Hamano, M. Horio, T. Sugaya, T. Ito, M. Hori, K. Okubo, and E. Imai Induction of Glia Maturation Factor-{beta} in Proximal Tubular Cells Leads to Vulnerability to Oxidative Injury through the p38 Pathway and Changes in Antioxidant Enzyme Activities J. Biol. Chem., August 29, 2003; 278(35): 33519 - 33527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ling, X. Li, S. Jha, W. Wang, L. Karetskaya, B. Pratt, and S. Ledbetter Therapeutic Role of TGF-{beta}-Neutralizing Antibody in Mouse Cyclosporin A Nephropathy: Morphologic Improvement Associated with Functional Preservation J. Am. Soc. Nephrol., February 1, 2003; 14(2): 377 - 388. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Pavenstadt, W. Kriz, and M. Kretzler Cell Biology of the Glomerular Podocyte Physiol Rev, January 1, 2003; 83(1): 253 - 307. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
, PAN; 
, sham;
*, P < 0.05; **, P < 0.01, PAN
versus sham.
, sham; *, P <
0.05, PAN versus sham.
