 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Department of Urology, Osaka University Graduate School of Medicine,
Osaka, Japan
Department of Anatomy and Biology, Osaka Medical College, Osaka,
Japan
Department of Urology, Osaka University Graduate School of Medicine,
Osaka, Japan
Division of Biochemistry, Biomedical Research Center, Osaka University
Graduate School of Medicine, Osaka, Japan
||
Department of Internal Medicine and Therapeutics, Osaka University
Graduate School of Medicine, Osaka, Japan
¶
Laboratory of Immunogenetics and Transplantation, Brigham and Women's
Hospital, Harvard Medical School, Boston, Massachusetts.
Correspondence to Dr. Shiro Takahara, Department of Urology, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka 565-0871, Japan. Phone: +81-6-6879-3531; Fax: +81-6-6879-3539; E-mail: takahara{at}uro.med.osaka-u.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-actin, occurred during the same period.
Control animals ultimately developed features typical of CAN, with functional
deterioration and severe histologic changes; a survival rate of 50.6% by 32 wk
was observed. In contrast, remarkably little early injury and no late
fibrogenic events were observed for the HGF-treated group. All treated animals
survived, with well preserved graft function, during the 32-wk follow-up
period. These results indicate that renal protection and recovery from early
allograft injury with HGF treatment greatly contribute to a reduction of
susceptibility to the subsequent development of CAN in a rat model. The
potential application of HGF in the prevention of CAN warrants further
attention. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Hepatocyte growth factor (HGF), which was originally identified and cloned as a potent mitogen for mature hepatocytes (6), plays diverse roles in the regeneration of the kidney (7,8,9). It exerts mitogenic and antiapoptotic actions (7,10,11,12,13,14,15) and induces branching tubulogenesis in renal tubular cells (7,11,16). The expression of HGF and its receptor, c-Met, is rapidly upregulated in renal tissue after unilateral nephrectomy or renal injury caused by renal ischemia or nephrotoxic compounds (17,18,19,20). Furthermore, previous reports demonstrated that HGF protected and salvaged renal tubular cells from renal injuries, acting as a mitogenic renotropic factor (19,21,22). These data strongly suggest that HGF enhances renal regeneration and affords protection to kidneys subjected to acute renal injury, including renal ischemia. We therefore conducted this study to examine the potential effects and mechanisms of action of HGF treatment in the development of CAN in a well established rat model of CAN. In this study, we demonstrate that HGF treatment during the initial 4 wk after engraftment remarkably prevented the onset of CAN and associated death.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Administration of HGF and Experimental Design
Recombinant human HGF was purified from the culture medium of Chinese
hamster ovary cells that had been transfected with expression vector
containing HGF cDNA
(6,22).
In this preparation, the purity of HGF exceeds 98%, as determined by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis and protein staining. One
hundred micrograms of HGF dissolved in 0.5 ml of saline was administered daily
through the penile vein for 4 wk after engraftment (HGF group). Control
animals received saline solution (control group). Animals were killed at 2, 4,
6, and 14 d after transplantation, for investigation of changes in early
periods, and at 8, 16, and 32 wk after transplantation, for investigation of
changes in the late phase. More than five animals/time point were used in each
group.
Graft Function
Alternate-day 24-h urine samples were collected for the first 2 wk after
transplantation and then every 2 wk until the end of the experiment. Protein
excretion was determined by measuring precipitation after the addition of 3%
sulfosalicylic acid to the urine. Turbidity was assessed by measuring
absorbance at a wavelength of 595 nm, using a spectrophotometer. Blood samples
were obtained from recipients every 4 wk, and the serum creatinine levels were
determined by using the Jaffe reaction method.
Morphologic Assessments
Renal tissues were fixed in 4% paraformaldehyde in phosphate-buffered
saline. Paraffin sections were stained with hematoxylin and eosin and with
periodic acid-Schiff stain and were then assessed by light microscopy. The
frequency of focal and segmental glomerulosclerosis and hyalinosis was
determined by examining all glomeruli in the section; the number of glomeruli
with sclerotic changes was expressed as a percentage of the total number of
glomeruli counted. For arterial changes, the number of affected arteries
demonstrating luminal narrowing and intimal and smooth muscle cell
proliferation was expressed as a percentage of the total number of arteries in
the section.
Immunohistochemical Analyses
Staining for ED1-positive macrophages was performed with the alkaline
phosphatase/anti-alkaline phosphatase method, using a Dako APAAP kit (Dako
Japan, Kyoto, Japan) according to the instructions provided by the
manufacturer. A monoclonal antibody against ED1 was purchased from Quantum
Appligene (Parc d'Innovation, Illkirch, France). Staining for intercellular
adhesion molecule-1 (ICAM-1), monocyte chemoattractant protein-1 (MCP-1), and
fibronectin was performed with the indirect immunoperoxidase method, using a
Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA). Monoclonal
antibodies against ICAM-1, MCP-1, and fibronectin were purchased from Santa
Cruz Biotechnology (Santa Cruz, CA), Pepro Tech (London, England), and
Chemicon International (Temecula, CA), respectively. Smooth muscle
-actin (SMA) was stained with the direct immunoperoxidase
staining method, using an EPOS kit (Dako Japan). The reaction product was
observed with 3,3'-diaminobenzidine.
The number of marker-positive cells was expressed as the mean ± SD of the number of cells/field of view. More than 20 fields of view were evaluated, at a magnification of x400, for each section/specimen. For evaluation of macrophage infiltration into glomeruli, more than eight glomeruli (>160 µm in diameter) were selected and the number of infiltrating marker-positive cells was counted and expressed as the mean ± SD of the number of cells/glomerulus. The expression of adhesion molecules, cytokines, and extracellular matrix was quantified on a scale of 0 to 4+ (4+ = dense).
Terminal Deoxynucleotidyl Transferase-Mediated dUTP-Biotin
Nick-End-Labeling Staining
Tissue sections were prepared as described previously
(24) and fixed in 4%
paraformaldehyde in phosphate-buffered saline. DNA fragmentation was observed
using an in situ apoptosis detection kit, according to the
instructions provided by the manufacturer (Takara, Tokyo, Japan).
Transmission Electron Microscopy
Small kidney blocks were washed and fixed overnight at 4°C with 2%
glutaraldehyde in 0.2 M sodium cacodylate buffer, postfixed with 1% osmium
tetroxide in 0.2 M sodium cacodylate buffer, dehydrated, and embedded in Epon
812 (NACALAI TESQUE, Kyoto, Japan). Ultrathin sections were poststained with
uranyl acetate and lead citrate and viewed with a transmission electron
microscope (H7100; Hitachi, Tokyo, Japan).
Analysis of DNA Fragmentation by Agarose Gel Electrophoresis
Collected frozen kidney tissues were homogenized and lysed on ice for 20
min in a buffer containing 0.5% Triton X-100, 20 mM
ethylenediaminetetraacetate, and 10 mM Tris (pH 8.0). DNA fragments were
separated from intact chromatin by centrifugation for 15 min at 15,000 rpm.
DNA in the supernatants (fragmented DNA) was precipitated in isopropanol
containing 0.5 M NaCl, digested for 60 min at 37°C with 1 mg/ml RNase A
and 200 µg/ml proteinase K, and subjected to electrophoresis in a 1.5%
agarose gel. DNA was subsequently observed by ethidium bromide staining.
Reverse Transcription-PCR Assays
RNA was extracted from tissues using RNeasy total RNA kits (Quiagen,
Hilden, Germany), according to the instructions provided by the manufacturer.
The quality of the RNA was confirmed with formaldehyde-agarose gel
electrophoresis, and the cDNA were prepared as described previously
(25). PCR was performed with a
GeneAmp 9600 PCR system (Perkin-Elmer, Norwalk, CT), using primers for MCP-1,
transforming growth factor-ß1 (TGF-ß1), tumor necrosis
factor- (TNF-), interleukin-6 (IL-6), inducible nitric oxide
synthase (iNOS), and glyceraldehyde-3-phosphate dehydrogenase (G3PDH).
[32P]dCTP was included for quantitative PCR. The primer sequences
and numbers of cycles were as follows: MCP-1, 5' primer,
ATGCAGGTCTCTGTCACG; 3' primer, CTAGTTCTCTGTCATACT (28 cycles);
TGF-ß1, 5' primer, TGAACCAAGGAGACGGAATACAGG; 3' primer,
TACTGTGTGTCCAGGCTCCAAATG (26 cycles); TNF-, 5' primer,
TACTGAACTTCGGGGTGATTGGTCC; 3' primer, CAGCCTTGTCCCTTGAAGAGAACC (30
cycles); IL-6, 5' primer, CAAGAGACTTCCAGCCAGTTGC; 3' primer,
TTGCCGAGTAGACCTCATAGTGACC (30 cycles); iNOS, 5' primer,
TGCCAGGGTCACAACTTTACAGG; 3' primer, GGTCGATGTCACATGCAGCTTGTC (35
cycles). The annealing temperature for PCR was optimized for each reaction.
PCR products were subjected to electrophoresis on 1.5% agarose gels, and
[32P]dCTP incorporated into specific bands of PCR products was
measured on dried gels using a PhosphorImager system (Molecular Dynamics,
Sunnyvale, CA), as described elsewhere
(26). PCR amplification of
G3PDH was performed to assess variations in total RNA or cDNA loading among
samples. Corrected values were derived by dividing the measured 32P
value for the transcript of interest by the mean G3PDH value for that sample.
PCR analysis was performed for all samples, and each analysis was performed at
least four times. The mean value for the corrected levels was obtained by
pooling measurements for all animals in each experimental group.
Statistical Analyses
One-way ANOVA was performed for the proteinuria and serum creatinine
concentration values. Graft survival was evaluated with the Wilcoxon test. The
unpaired t test was used for cellular infiltration in
immunohistochemical analyses. The Mann-Whitney U test was used for
histologic analyses and immunohistochemical data on the expression of adhesion
molecules, cytokines, and extracellular matrix. Results from reverse
transcription-PCR assays were subjected to ANOVA without replication. If the
ANOVA results indicated significance, then individual comparisons were
performed using the t test. P values of <0.05 were
considered to be statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Remarkable Decreases in Cell Necrosis with HGF Treatment
These initial changes in the allografts were further investigated by
terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end-labeling
(TUNEL) staining, transmission electron microscopy, and DNA gel
electrophoresis. TUNEL staining demonstrated many positive cells in the
kidneys from the control group, particularly in the proximal tubules in the
cortex and outer medulla on day 4 after engraftment
(Figure 2, a, b, and e). In
contrast, the number of TUNEL-positive cells was significantly reduced in the
kidneys from HGF-treated animals (Figure 2,
c, d, and e).
|
Transmission electron microscopy demonstrated that many tubular cells exhibited characteristics of cell necrosis, i.e., deformed nuclei, cytoplasmic vacuoles, and degenerative organelles, with particularly swollen and enlarged mitochondria (Figure 3a). In contrast, in the kidneys from HGF-treated animals, most tubular cells were morphologically well preserved, with intact nuclei and mitochondrial architecture and a fine chromatic pattern (Figure 3b). The DNA fragmentation pattern for the samples from the control group on day 4 demonstrated a predominant smear resulting from random DNA degradation, which is compatible with necrotic cell death (Figure 3c), whereas no smear pattern was noted during the initial 1 wk for the kidneys from HGF-treated animals.
|
Prevention of Animal Death and Significant Preservation of Graft
Function for Long Periods with HGF Treatment
Almost one-half (49.4%) of the animals in the control group died by 32 wk,
compared with no deaths in the HGF-treated group.
Figure 4 presents animal
survival times. Renal function, as indicated by serum creatinine levels and
proteinuria, was also markedly different between the two groups. The serum
creatinine levels for control recipients began to increase 16 wk after
transplantation and continued to increase thereafter. In contrast, the serum
creatinine levels for HGF-treated rats remained stable, within the normal
range, throughout the follow-up period
(Figure 5A). The mean serum
creatinine concentration for surviving recipients in the control group was
more than threefold higher than that for HGF-treated rats (2.73 ± 1.63
versus 0.77 ± 0.10 mg/dl, P < 0.05) at 32 wk after
transplantation. Likewise, a variable degree of proteinuria was observed for
the control recipients starting 16 wk after transplantation. Urinary protein
levels progressively increased until 32 wk after transplantation, whereas no
excessive proteinuria was observed in the treated group during the follow-up
period (62.0 ± 41.8 versus 11.4 ± 0.8 mg/dl at 32 wk,
P < 0.05) (Figure
5B). These results indicate that HGF treatment also significantly
prevented progressive late graft dysfunction.
|
|
Remarkable Preservation of Graft Morphologic Features in Allografts
from HGF-Treated Recipients throughout the Follow-up Period
Consistent with the results of the renal function studies, HGF treatment
remarkably prevented the histologic changes of graft destruction that were
observed for the control group. In grafts collected from the control group 8
wk after transplantation, there was evidence of scant mononuclear cell
infiltration in the periglomerular and perivascular areas, with a small number
of atrophic tubules. By 16 wk, this cellular infiltration had become more
florid in the glomeruli and perivascular areas, and the tubules associated
with damaged glomeruli exhibited striking atrophy. By 32 wk, interstitial
fibrosis had become widespread and was accompanied by severe tubular atrophy;
some tubules exhibited remarkable dilation, with intratubular casts
(Figure 6a). Almost 40% of
glomeruli developed various degrees of glomerulosclerosis, with wrinkling and
collapse of glomerular capillaries, mesangial cell proliferation, and
peripheral mesangial interposition (Figure
6, b and g). Some glomeruli developed remarkable cellular
crescents. Arterial changes were also manifest, with luminal narrowing and
intimal and smooth muscle cell proliferation
(Figure 6, c and g). In
contrast, in the HGF-treated recipients, most glomeruli remained normal, with
significantly decreased interstitial fibrosis and tubular changes and only
minimal vascular abnormalities (Figure 6, d
through g).
|
Reduced Macrophage Infiltration, Inflammatory Responses, and
Fibrogenic Events at Late Times with HGF Treatment
In the control recipients, dense expression of SMA (a marker of
myofibroblasts involved in the development of renal fibrosis) appeared in the
interstitial areas, especially in the outer medulla, by 8 wk after
transplantation (Figure 7, a and
b). Upregulation of ICAM-1, which is involved in the inflammatory
reaction in grafted kidneys, was observed in the glomeruli and arterial intima
during the same time period (Figure 7, e
and f). In contrast, the expression of SMA was
significantly reduced in the interstitial areas
(Figure 7, c and d) and ICAM-1
expression was remarkably decreased in the glomeruli and arteries in kidneys
from rats treated with HGF (Figure 7, g and
h).
|
We then examined macrophage infiltration, cytokine production, and extracellular matrix expression, which are considered essential in the development of CAN. A relatively small number of infiltrating ED1-positive macrophages was apparent in the periglomerular and perivascular areas by 8 wk. This population increased dramatically by 16 wk (Figure 8), localizing preferentially in the glomeruli (6.4 ± 0.8/glomerulus versus 3.7 ± 0.5/glomerulus, P < 0.01) and perivascular areas (Figure 9, a and b). MCP-1 expression was upregulated, especially in the glomeruli, and macrophage infiltration was observed (Figure 9c; Table 1). Dense expression of fibronection appeared particularly in the perivascular areas (Figure 9d; Table 1). In contrast, in the kidneys from recipients treated with HGF, infiltration of ED1-positive macrophages was strikingly suppressed throughout the graft tissue at 16 wk (Figures 8 and 9, e and f), and remarkably decreased expression of MCP-1 and fibronectin was observed throughout the follow-up period (Figure 9, g and h; Table 1).
|
|
|
The mRNA production of macrophage-associated proteins, such as MCP-1,
TGF-ß1, TNF-, IL-6, and iNOS, was evaluated by semiquantitative
reverse transcription-PCR. In the grafts from control recipients, the mRNA
production of MCP-1 and TGF-ß1 was significantly increased after 8 wk
(Figure 10). The production of
TNF-, IL-6, and iNOS was progressively augmented by 32 wk. In contrast,
those products exhibited different patterns of expression in the HGF-treated
group, with much smaller peaks of measurable mRNA, compared with control
values, through the 32-wk follow-up period.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The mechanisms that cause CAN are currently poorly understood. Although the process of CAN is primarily related to MHC disparities, Tilney (2) revealed that changes similar to CAN developed in human kidney transplants between identical twins, as well as in rat kidney isografts (3). Such changes cannot be explained by antigen-dependent factors; antigen-independent factors are likely to be involved in the onset of CAN (27,28). Several reports have indicated that initial ischemic injury is one of the major risk factors for the development of CAN (1,29,30). Our previous report that demonstrated that nontransplanted single-kidney rats subjected to renal ischemia developed long-term changes similar to CAN emphasized the importance of ischemic injury as a precipitating factor in the development of CAN (31). In this study, severe injury, producing structural deformity and collapse, was observed in the proximal tubules and outer medulla of allografts from non-HGF-treated animals in the first 1 wk after engraftment. A large number of necrotic tubular cells were observed in these regions. By comparison, graft tissue from HGF-treated animals was well preserved, with no evidence of cell necrosis, during this period. Morphologic changes resulting from ischemic injury occur predominantly in proximal tubules and the medullary thick ascending limb of Henle (32). The changes are potentially reversible, and recovery has been demonstrated to occur through the regeneration of replacement of injured cells (33). Previous studies indicated that HGF promotes DNA synthesis in renal tubular cells in vitro (10,34) and that rats given HGF after acute renal injury caused by renal ischemia or nephrotoxic compounds exhibited more satisfactory renal function and much less histologic damage, compared with control rats (19,21,22). The results presented here indicate that ischemic injury is a critical event in the early period after engraftment and that HGF salvaged and protected allografts from such early injury after engraftment.
After a period of quiescence, sequential inflammatory responses, including
upregulation of ICAM-1 and MCP-1, occurred and were accompanied by a dramatic
influx of macrophages by 16 wk after transplantation
(35,36).
Infiltrating macrophages are thought to be responsible for increased
production of cytokines such as TGF-ß1, TNF-, and IL-6, which are
known to cause sclerotic changes in glomeruli by promoting mesangial cell
proliferation and production of extracellular matrix
(37,38,39,40,41).
Concomitant with these changes, molecular and cellular events leading to
tissue fibrosis became more evident. Dense expression of SMA, which is
responsible for the accumulation of extracellular matrix proteins, appeared
with augmented production of TGF-ß1, which plays a critical role in the
onset of renal fibrosis
(42,43).
Dense expression of the extracellular matrix protein fibronectin appeared, and
allografts ultimately developed severe widespread renal fibrosis. In contrast
to the findings for control animals, these sequential inflammatory and
fibrogenic events were remarkably suppressed in the allografts from
HGF-treated animals, with prevention of progression to CAN. This indicates
that such inflammatory and fibrogenic events are critical in the development
of CAN. Prevention of early injury through the restoration of damaged cells
may be the underlying mechanism for the beneficial effects of HGF on the
long-term functioning of these allografts.
Although the exact mechanisms of such inflammatory and fibrogenic changes in allografted kidneys remain unclear, insufficient nephron numbers are possibly involved in the processes. As we previously observed in a rat kidney transplant model, renal allograft ablation accelerated CAN changes, which included parallel changes in the sequential patterns of cytokine production and adhesion molecule expression (4,44). Conversely, recipients with increased kidney mass, bearing two allografts, did not exhibit any signs of CAN (4,45). Several clinical reports support the concept that insufficient nephron mass is an important factor in the development of CAN (46,47). Therefore, it can be hypothesized that the presence of insufficient nephron numbers for long periods, resulting from early ischemic injury, is a critical factor in subsequent inflammatory and fibrogenic changes in allografted kidneys, although this issue remains to be further explored. Recovery from initial insults with HGF treatment may preserve more functioning nephrons in the long term, which may prevent the development of CAN. We recently reported that the neutralization of endogenous HGF with anti-HGF IgG treatment accelerated the progression of tubular destruction, resulting in renal fibrosis, whereas the administration of exogenous HGF for a period of 4 wk suppressed fibrogenic events in a mouse nephrotic model (14). This study may support this hypothesis, but it remains to be determined whether HGF treatment at later times, after the onset of ischemic injury, can prevent the progression of CAN.
Recent improvements in immunosuppressive therapy have led to dramatic increases in renal cadaveric graft survival rates (especially the short-term rate of 87.7%); however, >20% of patients resume hemodialysis within 5 yr because of late graft loss (48). Although CAN is one of the major causes of such late graft loss, no practical treatment has been established. The results presented here suggest that HGF is a promising candidate for the prevention of CAN in the clinical setting. The potential therapeutic value of HGF in preventing the onset of CAN warrants further attention and preclinical studies.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M. Giannopoulou, C. Dai, X. Tan, X. Wen, G. K. Michalopoulos, and Y. Liu Hepatocyte Growth Factor Exerts Its Anti-Inflammatory Action by Disrupting Nuclear Factor-{kappa}B Signaling Am. J. Pathol., July 1, 2008; 173(1): 30 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Jevnikar and R. B. Mannon Late Kidney Allograft Loss: What We Know about It, and What We Can Do about It Clin. J. Am. Soc. Nephrol., March 1, 2008; 3(Supplement_2): S56 - S67. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Tan, X. Zhang, J. Yang, Y. Li, and Y. Liu Molecular Basis for the Cell Type Specific Induction of SnoN Expression by Hepatocyte Growth Factor J. Am. Soc. Nephrol., August 1, 2007; 18(8): 2340 - 2349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Zhang, M.-H. Wang, Z. Dong, and T. Yang Prostaglandin E2 is a potent inhibitor of epithelial-to-mesenchymal transition: interaction with hepatocyte growth factor Am J Physiol Renal Physiol, December 1, 2006; 291(6): F1323 - F1331. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Marco The Fischer-Lewis model of chronic allograft rejection--a summary Nephrol. Dial. Transplant., November 1, 2006; 21(11): 3082 - 3086. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Beckmann, C. Cannet, S. Zurbruegg, R. Haberthur, J. Li, C. Pally, and C. Bruns Macrophage Infiltration Detected at MR Imaging in Rat Kidney Allografts: Early Marker of Chronic Rejection? Radiology, September 1, 2006; 240(3): 717 - 724. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Mizuno and T. Nakamura Prevention of Neutrophil Extravasation by Hepatocyte Growth Factor Leads to Attenuations of Tubular Apoptosis and Renal Dysfunction in Mouse Ischemic Kidneys Am. J. Pathol., June 1, 2005; 166(6): 1895 - 1905. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yang, C. Dai, and Y. Liu A Novel Mechanism by which Hepatocyte Growth Factor Blocks Tubular Epithelial to Mesenchymal Transition J. Am. Soc. Nephrol., January 1, 2005; 16(1): 68 - 78. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Dai, J. Yang, S. Bastacky, J. Xia, Y. Li, and Y. Liu Intravenous Administration of Hepatocyte Growth Factor Gene Ameliorates Diabetic Nephropathy in Mice J. Am. Soc. Nephrol., October 1, 2004; 15(10): 2637 - 2647. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Yamaura, K.-i. Ito, K. Tsukioka, Y. Wada, A. Makiuchi, M. Sakaguchi, T. Akashima, M. Fujimori, Y. Sawa, R. Morishita, et al. Suppression of Acute and Chronic Rejection by Hepatocyte Growth Factor in a Murine Model of Cardiac Transplantation: Induction of Tolerance and Prevention of Cardiac Allograft Vasculopathy Circulation, September 21, 2004; 110(12): 1650 - 1657. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Liu Hepatocyte growth factor in kidney fibrosis: therapeutic potential and mechanisms of action Am J Physiol Renal Physiol, July 1, 2004; 287(1): F7 - F16. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Cruzado, N. Lloberas, J. Torras, M. Riera, C. Fillat, I. Herrero-Fresneda, J. M. Aran, G. Alperovich, A. Vidal, and J. M. Grinyo Regression of Advanced Diabetic Nephropathy by Hepatocyte Growth Factor Gene Therapy in Rats Diabetes, April 1, 2004; 53(4): 1119 - 1127. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Liu Epithelial to Mesenchymal Transition in Renal Fibrogenesis: Pathologic Significance, Molecular Mechanism, and Therapeutic Intervention J. Am. Soc. Nephrol., January 1, 2004; 15(1): 1 - 12. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Mizuno and T. Nakamura Suppressions of chronic glomerular injuries and TGF-{beta}1 production by HGF in attenuation of murine diabetic nephropathy Am J Physiol Renal Physiol, January 1, 2004; 286(1): F134 - F143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Poulsom, M. R. Alison, T. Cook, R. Jeffery, E. Ryan, S. J. Forbes, T. Hunt, S. Wyles, and N. A. Wright Bone Marrow Stem Cells Contribute to Healing of the Kidney J. Am. Soc. Nephrol., June 1, 2003; 14(90001): S48 - 54. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Yang and Y. Liu Delayed administration of hepatocyte growth factor reduces renal fibrosis in obstructive nephropathy Am J Physiol Renal Physiol, February 1, 2003; 284(2): F349 - F357. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||
