2007 JASN IMPACT FACTOR 7.111	HOME   AUTHOR INFO   EDITORIAL BOARD   SUBSCRIBE   FEEDBACK   ALERTS   HELP
advanced	CURRENT ISSUE	ARCHIVES	JASN Express	ONLINE SUBMISSION

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by SARANG, S. S. Articles by SCHNELLMANN, R. G. Search for Related Content PubMed PubMed Citation Articles by SARANG, S. S. Articles by SCHNELLMANN, R. G.

Identification of the -Aminobutyric Acid Receptor ß₂ and ß₃ Subunits in Rat, Rabbit, and Human Kidneys

SATINDER S. SARANG^*,, MATTHEW D. PLOTKIN, STEVEN R. GULLANS, BRIAN S. CUMMINGS^*, DAVID F. GRANT^* and RICK G. SCHNELLMANN^*

^* Department of Pharmacology and Toxicology, University of Arkansas for Medical Sciences, Little Rock, Arkansas
Harvard Institutes of Medicine, Brigham and Women's Hospital, Renal Division, Boston, Massachusetts.

Correspondence to Dr. Rick G. Schnellmann, Division of Toxicology, University of Arkansas for Medical Sciences, 4301 W. Markham St., Slot 638, Little Rock, AR 72205-7199. Phone: 501-686-8883; Fax: 501-686-8970; E-mail: rschnell{at}biomed.uams.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Abstract. The properties and functions of -aminobutyric acid (GABA_A) receptors in the mammalian central nervous system are well studied. However, the presence and significance of GABA_A receptors in nonneural tissue is less clear. The goal of this study was to examine the expression and localization of the GABA_A receptor ß₂ and ß₃ subunits in the kidney. Reverse transcriptase products from RNA isolated from rat and rabbit kidney cortex and cerebellum and rabbit S₂ segments were amplified by use of PCR and GABA_A ß₂ and ß₃ subunit—specific primers. Sequencing of the kidney PCR products revealed that the rat kidney cortex and rat neuronal GABA_A receptor ß₂ subunit were identical in nucleotide composition. The rabbit kidney and rabbit neuronal GABA_A receptor ß₂ subunit were 99% identical in nucleotide composition. Sequencing of the kidney PCR products revealed that the rat kidney cortex and rat neuronal GABA_A receptor ß₃ subunits were 93% and 95% identical in nucleotide and amino acid composition, and rabbit kidney cortex and rabbit neuronal GABA_A receptor ß₃ subunits were 95% and 98% identical in nucleotide and amino acid composition, respectively. PCR screening of a human kidney cDNA library and sequencing revealed that the human kidney cortex and neuronal ß₃ subunits were identical in nucleotide composition. Immunoblot analysis of rat kidney cortex and brain identified immunoreactive proteins in the 55 to 57 kD region, corresponding to the GABA_A receptor ß₂ and ß₃ subunits. Immunohistochemistry revealed cytosolic and basolateral staining of the proximal convoluted and straight tubule. These results provide compelling evidence for the expression of the GABA_A receptor ß₂ and ß₃ subunits in the kidney of multiple species and the localization of the ß₂/ß₃ subunits to the renal proximal tubule.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
-Aminobutyric acid (GABA) is an important neurotransmitter in the mammalian central nervous system (CNS) and modulates inhibitory tone throughout the CNS by activating three types of receptors, GABA_A, GABA_B, and GABA_C (1). GABA_A receptors have been identified outside the CNS as well, in the anterior and intermediate lobe of the pituitary, the -cells of the pancreas, and the adrenal medulla (2,3,4). Recently, GABA_A receptor subunit and subunits were identified in the heart and the uterus, respectively (5,6).

Nicotinic, glycine, and GABA_A receptors belong to the same gene superfamily (7). Molecular biological approaches revealed that GABA_A receptors exist as a family of polypeptides composed of seven different GABA_A receptor subunits—namely, _1-6, ß_1-4, _1-3, , _1-2, , and (5,6). The GABA_A receptor is proposed to be a hetero-oligomer composed of five subunits that form a pentameric structure, constituting a Cl^- channel. These GABA_A receptor subunits contain distinct binding sites for the benzodiazepines, barbiturates, convulsant compounds (e.g., picrotoxin), and neurosteroids (8). Heterologous expression systems showed that various combinations of GABA_A , ß, and subunits form functional Cl^- channels (9). Similarly, immunohistochemical, immunoprecipitation, immunoblotting, in situ hybridization, and ligand-binding studies demonstrated the heterogeneity of neuronal GABA_A receptor complexes (10).

There is emerging evidence of neuronal Cl^- -channel subunits such as GABA_A subunits and glycine receptor subunits in renal tubular epithelial cells. For example, ligand-binding studies and autoradiography with use of the GABA_A receptor agonist [³H]muscimol demonstrated specific binding to convoluted proximal tubules of the rat renal cortex (11). In a preliminary report, Molony et al. (12) identified the mRNA for the ₁ subunit of the GABA_A receptor in the thick ascending limb of the loop of Henle but not in the proximal tubule or in glomeruli. With respect to the glycine receptor, PCR studies identified the glycine receptor ß subunit in human, rabbit, and rat kidney cortex, and immunofluorescence and immunoblotting localized the ß subunit to the basolateral membrane of rabbit renal proximal tubules (RPT) (13,14).

To date, no one has identified conclusively any GABA_A receptor subunits in the kidney. In this study, we focused on the identification and localization of the GABA_A receptor ß₂ and ß₃ subunit in the kidney. GABA_A receptor ß subunits have been shown to be essential for cell surface expression of functional GABA_A receptors in the mammalian CNS (15), are involved in lining of the Cl^- channel, and are one of the most ubiquitously expressed GABA_A receptor subunits (16). The goals of this study were to (1) examine the expression of the GABA_A receptor ß₂ and ß₃ subunits in rat, rabbit, and human kidneys and (2) determine the localization of the GABA_A receptor ß₂/ß₃ subunits in the rat kidney.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
RNA Isolation and Reverse Transcriptase-PCR Amplification
Female New Zealand white rabbits (1.5 to 2 kg) received an injection of 500 U/kg heparin sulfate and were killed with an overdose of sodium pentobarbital (50 mg/kg); the kidneys and the brain were removed, and the cerebellum and the renal cortex were recovered. Male Sprague-Dawley rats (300 to 350 g) were killed with diethyl ether, the kidneys and the brain were removed, and the renal cortex and the cerebellum were recovered. After perfusion of the rabbit kidney with 100 ml of ice-cold Dulbecco's modified Eagle's medium (Sigma, St. Louis, MO) and dissection into thin sections, RPT S₂ segments were isolated individually by use of microdissection in the absence of collagenase (17). Freshly isolated RPT S₂ segments were placed in ice-cold TRIzol reagent (Gibco-BRL, Grand Island, NY) and processed immediately. Total cellular RNA was isolated from the renal cortex, RPT S₂ segments, and cerebellum by use of TRIzol reagent, following the manufacturer's instructions. RNA concentration was measured, and the RNA was stored in RNase-free water at -80°C. Animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

The human and rat neuronal GABA_A receptor ß₂ subunit primary amino acid sequences were identified in the GenBank database (accession numbers S67368 and X15467, respectively). Two sets of primers were designed for use in nested PCR amplification studies: the outer sense primer (A_X) 5'CTGCCTGCATGATGGACCTAAGG3' and outer antisense primer (B_X) 5'CTCATGGGGGTCCATCTTGTTG3' and the inner sense primer (C_X) 5'GAGTTTTACTGGCGTGGCGATG3' and inner antisense primer (D_X) 5'GGCATATTCCAGAAGGGCCATG3' (Figure 1A).

View larger version (18K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 1. (A) Restriction map of the -aminobutyric acid (GABAA) receptor ß2 subunit, showing the location of the outer and nested primers, Ax, Bx, Cx, and Dx (see text), used in the PCR and reverse transcription-PCR (RT-PCR) studies. (B) Restriction map of the GABAA receptor ß3 subunit, showing the location of the outer and nested primers, A, B, C, D, and D1, used in the PCR and RT-PCR studies.

The rat, human, and mouse neuronal GABA_A receptor ß₃ subunit primary amino acid sequences were identified in the GenBank database (accession numbers X15468, M82919, and U14420, respectively). Two sets of primers were designed for use in nested PCR amplification studies: the outer sense primer (A) 5'TGGAGCACCGTCTGGTCTCCAGGA3' and outer antisense primer (B) 5'CGCTCATTCTTGGCCTTGGCTGT3', and the inner sense primer (C) 5'CCACAGGTGCCTACCCTCGA3', inner antisense primer (D) 5'GGCCTTGGCTGTCTTCTCCGCAA3', and specific human inner antisense primer 5'CTTTGCCTTGGCTGTCTTTTCTGCA3' (D1) (Figure 1B).

First-strand cDNA was synthesized from 2 µg of total cellular RNA from either rat or rabbit kidney cortex or cerebellum by use of Moloney murine leukemia virus reverse transcriptase (MuLV-RT; Perkin-Elmer, Foster City, CA) and a downstream primer (B_X, B), according to the manufacturer's instructions. Control experiments were conducted in which no RNA template or no RT was added to the RT reaction tubes. RT reactions were conducted in an Ericomp Power Block II thermal cycler (Ericomp, San Diego, CA). RT experiments consisted of 1 cycle of 60 min at 42°C, 5 min at 99°C, and 5 min at 5°C. The products from the RT reactions from rat and rabbit kidney cortex and cerebellum were amplified by PCR. First-round PCR for the GABA_A receptor ß₂ subunit was carried out for 1 cycle of 2 min at 94°C and 30 s at 72°C; 30 cycles of 30 s at 94°C, 30 s at 50°C, and 30 s at 72°C; and 1 cycle of 5 min at 72°C. PCR reamplification with the use of nested primers was performed for 30 cycles of 30 s at 94°C, 30 s at 50°C, and 30 s at 72°C. Similarly, first-round PCR for the GABA_A receptor ß₃ subunit was carried out for 1 cycle of 2 min at 94°C and 30 s at 72°C; 30 cycles of 45 s at 94°C, 60 s at 55°C, and 60 s at 72°C; and 1 cycle of 5 min at 72°C. PCR reamplification with the use of nested primers was performed for 30 cycles of 30 s at 94°C, 30 s at 54°C, and 30 s at 72°C. Known regions of human GABA_A ß₃ subunit were amplified by PCR with the use of GABA_A receptor ß₃ subunit—specific primers and a human kidney cDNA library (18). The PCR experiments were performed as described above. The PCR DNA products were analyzed by electrophoresis in 1.5% agarose gels containing 0.5 µg/ml ethidium bromide and viewed under ultraviolet light.

After PCR amplification that used the GABA_A receptor ß₃ subunit nested primers (C and D or D1), rat and rabbit brain and kidney PCR products were incubated with the restriction enzyme XhoI (15 U) (New England Biolabs, Beverly, MA) and human kidney PCR products with NsiI (15 U) for 2 h at 37°C. Control reactions were conducted in the absence of the restriction enzyme.

The GABA_A receptor ß₂ subunit DNA band at 407 bp from rat and rabbit kidney cortex and cerebellum were isolated from the agarose gel after the second round of PCR amplification with the QIAquick Gel Extraction Kit (Qiagen, Chatsworth, CA). Similarly, the GABA_A receptor ß₃ subunit DNA band at 370 bp from rat and rabbit kidney cortex and cerebellum and a 373-bp DNA band from human kidney were isolated from the agarose gel after the second round of PCR amplification with the QIAquick Gel Extraction Kit (Qiagen). The 407-, 370-, and 373-bp DNA fragments were sequenced directly by the use of an automated DNA sequencer (Perkin-Elmer).

Localization of GABA_A Receptor ß₂/ß₃ Subunit in the Rat Kidney by Immunohistochemistry
Male Sprague-Dawley and Wistar rats (250 to 300 g) were anesthetized with phenobarbital (50 mg/kg intraperitoneally), and the kidneys were perfused in situ with phosphate-buffered saline (PBS) containing mammalian protease inhibitors (100 µ1/100 ml of Sigma mammalian protease inhibitor, catalog P-3840) for 10 min at 4°C. Kidneys then were perfused with 4% paraformaldehyde in PBS for 10 min, removed, bisected, and placed in 30% (wt/vol) sucrose overnight. Individual bisections were embedded in paraffin, and 10-µm sections were cut. Sections were rehydrated, washed three times in PBS, and incubated with 2% normal horse serum to block nonspecific binding. Sections then were washed three times with PBS and incubated for 2 h with GABA_A receptor subunit mouse monoclonal antibodies (1:20 dilution, 623G1 [a gift from Dr. Angel De Blas, University of Connecticut] or 1:20 dilution of bd-17; Chemicon, Temecula, CA) that recoginze both the ß₂/ß₃ subunits of the GABA_A receptor or control (mouse IgG₁ 1:20 dilution; Molecular Probes, Eugene, OR). After three washes with PBS, sections were incubated for 2 h with a FITC-conjugated rabbit anti-mouse secondary antibody (Molecular Probes) in PBS and 1% bovine serum albumin. Sections then were washed three times with PBS; mounting media (Sigma) was added, and cover slips were applied. The localization of the GABA_A ß₂/ß₃ subunits' staining was determined by fluorescence microscopy. The GABA_A receptor anti-ß₂/ß₃ subunit mouse monoclonal antibodies 623G1 and bd-17 have identical subunit specificity and bind to the same epitopes on the ß₂/ß₃ subunit (19). Experiments to detect GABA_A ß₂/ß₃ staining also were performed with the use of avidin-biotin complex immunoperoxidase. No difference in staining was detected between the two methods.

Immunoblot Analysis
Crude membrane proteins from rat kidney cortex and brain cortex were isolated by homogenization in ice-cold sucrose buffer (0.32 M sucrose, 5 mM Tris-HCl [pH 7.5], and 2 mM ethylenediaminetetraacetate [EDTA]) and centrifuged at 3000 x g. The supernatants were centrifuged at 20,000 x g, and the resulting supernatants were centrifuged at 100,000 x g (all procedures were performed at 4°C). The pellets were resuspended in a buffer containing 5 mM Tris-HCl (pH 7.5) and 2 mM EDTA. Protein concentrations were determined by the use of a BioRad assay (BioRad, Hercules, CA). Equal amounts of protein (200 µg/lane) were resolved by sodium dodecyl sulfate—polyacrylamide gel electrophoresis and transferred onto polyvinylidine difluoride membranes (BioRad). Membranes were probed with the GABA_A receptor anti-ß₂/ß₃ subunit mouse monoclonal antibody 623G1 (1:20 dilution). Proteins were detected by the use of enhanced chemiluminescence (Amersham, Arlington Heights, IL) and developed with autoradiography film.

Northern Blot Analysis
Northern blots were performed by the use of poly(A⁺) RNA purified from rat brain, kidney cortex, and outer medulla. A ³²P-labeled GABA_A ß₃ subunit—specific probe encoding a 2.4-kb sequence region was used. Each lane contained 3 µg of poly(A⁺) RNA, and the blots were probed under high stringency in 5x saline—sodium phosphate—EDTA (1x saline—sodium phosphate—EDTA is 0.18 M NaCl, 10 mM sodium phosphate [pH 7.4], and 1 mM EDTA) containing 50% formamide at 42°C. Filters were washed in 0.3x saline—sodium phosphate—EDTA at 65°C and exposed to Kodak XAR film (Rochester, NY) for 3 d at -70°C.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Total RNA was isolated from both rat and rabbit kidney cortex and cerebellum. RT products were amplified by PCR by the use of rat neuronal GABA_A receptor ß₂ and ß₃ subunit—specific primers (Figure 1). First-round PCR amplification of rat and rabbit kidney cortex and cerebellum and rabbit RPT S₂ segments with the use of GABA_A receptor ß₂ outer primers identified a 619-bp fragment, and, on further amplification with the use of nested primers, a 407-bp fragment was obtained (Figure 2A). This region encodes three of the four transmembrane domains (M1, M2, and M3) and intracellular and extracellular loops of the GABA_A receptor ß₂ subunit (20). Sequencing of the PCR products and sequence alignment revealed that the rat kidney cortex and rat neuronal GABA_A receptor ß₂ subunit were identical in nucleotide and amino acid composition, respectively. Sequencing of the PCR products revealed that the rabbit kidney cortex and rabbit neuronal GABA_A receptor ß₂ subunits were 99% identical in nucleotide and amino acid composition.

View larger version (65K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 2. (A) RT-PCR reamplification with the use of GABAA receptor ß2 subunit nested primers. Products were analyzed by 1.5% agarose gel electrophoresis containing ethidium bromide. Lane 1, no rat brain (water, control); lane 2, rat brain cerebellum (RNA); lane 3, DNA marker; lane 4, rat kidney cortex (RNA); lane 5, rabbit brain cerebellum (RNA); lane 6, rabbit kidney cortex (RNA); and lane 7, rabbit renal proximal tubule (RPT) S2 segments (RNA). (B) RT-PCR reamplification with the use of GABAA receptor ß3 subunit nested primers and restriction enzyme digest of the 370-bp PCR product with use of XhoI. Products were analyzed by 1.5% agarose gel electrophoresis containing ethidium bromide. Lane 1, no rat brain (water, control); lane 2, rat brain cerebellum (RNA); lane 3, rat brain cerebellum with XhoI; lane 4, rat kidney cortex (RNA); lane 5, rat kidney cortex (RNA) with XhoI; lane 6, rabbit brain cerebellum (RNA); lane 7, rabbit brain cerebellum with XhoI; lane 8, rabbit kidney cortex (RNA); lane 9, rabbit kidney cortex with XhoI; and lane 10, rabbit RPT S2 segments; M, DNA bp marker. Representative of five experiments.

First-round PCR amplification of rat and rabbit kidney cortex and cerebellum and rabbit RPT S₂ segments with the use of ß₃ subunit outer primers identified a 418-bp fragment, and, on further amplification with the use of nested primers, a 370-bp fragment was obtained (Figure 2B). This region encodes three of the four transmembrane domains (M1, M2, and M3) and intracellular and extracellular loops of the GABA_A receptor ß₃ subunit (20). Restriction-enzyme digest of the rat kidney cortex and cerebellum 370-bp fragment with the use of XhoI yielded two predicted products of 226 and 144 bp (Figure 2B). Sequencing of the PCR products and sequence alignment revealed that the rat kidney cortex and rat neuronal GABA_A receptor ß₃ subunits were 93% and 95% identical in nucleotide and amino acid composition, respectively. However, restriction digest of the rabbit kidney cortex and cerebellum 370-bp fragment with use of XhoI did not result in any products, which suggests that the restriction site is not present (Figure 2B). Sequencing of the PCR products revealed that the rabbit kidney cortex and rabbit neuronal GABA_A receptor ß₃ subunits were 95% and 98% identical in nucleotide and amino acid composition, respectively. Examination of the rabbit kidney cortex and cerebellum sequence confirmed the absence of the XhoI restriction site.

PCR screening of a human kidney cDNA library with the use of outer primers designed from the human neuronal GABA_A receptor ß₃ subunit identified a 418-bp fragment (Figure 1, data not shown). Second-round PCR amplification with the use of GABA_A receptor ß₃ subunit nested primers (C and D1) identified a 373-bp fragment (Figures 1 and 3). Restriction digest with the use of the restriction enzyme NsiI yielded products of 237 and 136 bp (Figure 3). Sequencing of the 373-bp human kidney PCR products and sequence alignment revealed that the human kidney and human neuronal GABA_A receptor ß₃ subunits were identical in nucleotide identity. No PCR products were identified by the use of neuronal GABA_A receptor ß₂ subunit—specific primers and a human kidney cDNA library. These results provide strong evidence for the expression of the GABA_A receptor ß₂ and ß₃ subunits in rat and rabbit kidney and the GABA_A receptor ß₃ subunit in human kidney.

View larger version (70K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 3. PCR reamplification of the GABAA receptor ß3 subunit and restriction enzyme digest of the 373-bp PCR product with the use of NsiI. Products were analyzed by 1.5% agarose gel electrophoresis containing ethidium bromide. Lane 1, human kidney (cDNA library); lane 2, human kidney with NsiI; M, DNA bp marker. Representative of five experiments.

Northern blot analysis with the use of poly(A⁺) RNA from rat kidney cortex and outer medulla and whole rat brain revealed a 6.0-kb fragment in all cases, which corresponds to the GABA_A receptor ß₃ subunit (Figure 4).

View larger version (105K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 4. Northern blot analysis of the whole rat brain, kidney cortex, and outer medulla poly(A+) RNA by use of a probe against the GABAA receptor ß3 subunit. Lane 1, whole rat brain (3 µg); lane 2, rat kidney cortex (3 µg); and lane 3, rat kidney outer medulla (3 µg). Representative of three experiments.

Immunohistochemical studies were performed on rat kidney sections from two different strains (Sprague-Dawley and Wistar) and with the use of two different mouse monoclonal antibodies, 623G1 and bd-17, which are known to identify the neuronal GABA_A receptor ß₂/ß₃ subunits (19,21). Specific staining was observed in the cytosol and the basolateral region of the rat kidney proximal convoluted tubule and straight tubule (Figure 5). No staining was detected in the nuclei and brush border region of the rat proximal tubule or glomeruli. Control rat kidney sections that were incubated in the presence of IgG₁ and processed as described above did not exhibit any specific staining. Immunoblot analysis of the rat kidney cortex and brain cortex identified immunoreactive proteins in the 55- to 57-kD region, corresponding to the GABA_A receptor ß₂ and ß₃ subunits (Figure 6).

View larger version (167K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 5. Immunofluorescence localization of the GABAA receptor ß2/ß3 subunit in Sprague-Dawley and Wistar rat proximal tubule with the use of the monoclonal antibody (mAb) 623GI or mAb bd-17 (top and middle rows). Bottom row, fluorescence staining with use of a nonspecific IgG. Note immunoreactive staining in the cytosol and the basolateral region of the proximal tubule. No specific staining was observed in the glomeruli or in the brush border of the proximal tubule. Representative of five experiments. Magnification, x50.

View larger version (121K): [in this window] [in a new window] [as a PowerPoint slide]   Figure 6. Immunoblot analysis of rat brain cortex and rat kidney cortex with the use of the GABAA receptor ß2/ß3 subunit antibody 623G1. Representative of three experiments.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Several studies have suggested the presence of the GABA_A receptor in the kidney. Ligand-binding studies and autoradiography with the use of the GABA_A receptor agonist [³H]muscimol demonstrated specific binding to proximal convoluted tubules of the rat renal cortex (11). In a preliminary report, Molony et al. (12) identified the mRNA for the ₁-subunit of the GABA_A receptor in the thick ascending limb of the loop of Henle but not in the proximal tubule or in glomeruli. The present study determined the presence of the GABA_A receptor ß₂ and ß₃ subunits in rat, rabbit, and human kidney and in rabbit RPT S₂ segments. Using a variety of techniques, we obtained strong evidence for the presence of the GABA_A receptor ß₂ and ß₃ subunits in the rat and rabbit kidney and the ß₃ subunit in human kidney. Furthermore, the GABA_A receptor ß₃ subunit was found primarily in the cortex and the outer medulla, and the ß₂/ß₃ subunits were localized to the proximal tubule.

Sequencing of the PCR products and sequence alignment revealed that the rat kidney cortex and rat neuronal GABA_A receptor ß₂ subunits were identical in nucleotide and amino acid composition. Sequencing also revealed that the rabbit kidney cortex and rabbit neuronal GABA_A receptor ß₂ subunits were 99% identical in nucleotide and amino acid composition. Sequencing of the PCR products and sequence alignment revealed that the rat kidney cortex and rat neuronal GABA_A receptor ß₃ subunits were 93% and 95% identical in nucleotide and amino acid composition, respectively. Sequencing also revealed that the rabbit kidney cortex and rabbit neuronal GABA_A receptor ß₃ subunits were 95% and 98% identical in nucleotide and amino acid composition, respectively. The sequence data suggest that there are tissue-specific differences between the GABA_A receptor ß₃ subunits in the kidney and the brain of the rat and the rabbit. Sequencing of the PCR products from a human kidney cDNA library revealed that the human kidney and human neuronal GABA_A receptor ß₃ subunit between positions 730 and 1103 bp were identical in nucleotide and amino acid composition.

Immunohistochemical analysis of the rat kidney from two different rat strains and with the use of two different antibodies that recognize GABA_A receptor ß₂/ß₃ subunits revealed strong cytosolic and basolateral staining in the rat kidney proximal convoluted and straight tubules. No staining was observed in the nucleus or the brush border of the proximal tubule or in the glomeruli. These results indicate that the GABA_A receptor ß₂/ß₃ subunits are localized to the cytosol and the basolateral membrane of the rat proximal convoluted tubule and straight tubule. Furthermore, immunoblot studies identified 55- to 57-kD proteins corresponding to the GABA_A receptor ß₂/ß₃ subunits in rat kidney cortex.

The GABA_A receptor in the CNS is normally composed of five subunits, which form a pentameric Cl^- channel composed primarily of , ß, and subunits (22). It is not known what other GABA_A receptor subunits are associated with the GABA_A receptor ß₂ and ß₃ subunits in the kidney. Furthermore, the physiologic function of the GABA_A receptor ß₂ and ß₃ subunits in the kidney is not known. Considering that the only known function of the GABA_A receptor ß₃ subunit is the lining of a Cl^- channel, we hypothesize that the GABA_A receptor ß₂ and ß₃ subunits play a role in basolateral membrane Cl^- transport. These results are also intriguing, because it has been reported that the ß subunit of the neuronal glycine receptor also is found in the kidney. PCR studies identified the ß subunit of the glycine receptor in human, rabbit, and rat kidney cortex, and immunofluorescence and immunoblotting localized the ß subunit to the basolateral membrane of rabbit RPT (13,14).

In summary, using a variety of techniques, we provided compelling evidence for (1) the expression of the GABA_A receptor ß₂ and ß₃ subunits in the rat and rabbit kidney and the ß₃ subunit in the human kidney and (2) the localization of the GABA_A receptor ß₂/ß₃ subunit to the rat kidney proximal convoluted and straight tubules. Furthermore, these findings open the possibility that other subunits of the ligand-gated Cl^- channel superfamily, associated with GABA_A receptor ß₂ and ß₃ subunits, may be expressed in the kidney.

	Acknowledgments

 
The authors thank Dr. D. C. Zeldin for kindly providing the human kidney cDNA library and Dr. A. De Blas for furnishing the 623G1 antibody. The authors also thank Dr. Philip Mayeux for his aid in the immunohistochemistry and Stephanie Hasting for her help in preparing the kidney sections. S.S.S. was supported by an American Heart Association, Arkansas Affiliate Predoctoral Fellowship and by the University of Arkansas for Medical Sciences Committee for Allocation of Graduate Student Research Funds. S.R.G. was supported by a Grant-In-Aid from the American Heart Association. M.D.P. was supported by an individual National Research Service Award. B.S.C. was supported by an individual NRSA (DK10079). R.G.S. was supported by the National Institute of Diabetes and Digestive and Kidney Diseases (DK52946).

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Barnard EA, Skolnick P, Olsen RW, Mohler H, Sieghart W, Biggio G, Braestrup C, Bateson AN, Langer SN: International Union of Pharmacology. XV. Subtypes of gamma-aminobutyric acid_A receptors: Classification on the basis of subunit structure and receptor function. Pharmacol Rev 50: 291-313,1998[Abstract/Free Full Text]
2. Berman JA, Roberts JL, Pritchett DB: Molecular and pharmacological characterization of GABA_A receptors in the rat pituitary. J Neurochem 63:1948 -1954, 1994[Medline]
3. Erdo SL: Peripheral GABAergic mechanisms. Trends Pharmacol Sci 24:205 -208, 1985
4. Parramon M, Oset-Gasque MJ, Gonzalez MP, Stephenson FA: Identification of GABA_A receptor subunits expressed in bovine adrenal medulla. Neurosci Lett168 : 243-246,1994[Medline]
5. Whiting PJ, McAllister D, Vassilatis GD, Bonnert TP, Heavens RP, Smith DW, Hewson L, O'Donnell R, Rigby MR, Sirinathsinghji DJ, Marshall G, Thompson SA, Wafford KA, Vasilatis D: Neuronally restricted RNA splicing regulates the expression of a novel GABA_A receptor subunit conferring atypical functional properties. J Neurosci17 : 5027-5037,1997[Abstract/Free Full Text]
6. Hedblom E, Kirkness EF: A novel class of GABA_A receptor subunit in tissues of the reproductive system. J Biol Chem 272:15346 -15350, 1997[Abstract/Free Full Text]
7. Wallace DP, Tomich JM, Iwamoto T, Henderson K, Grantham JJ, Sullivan LP: A synthetic peptide derived from glycine-gated Cl^- channel induces transepithelial Cl^- and fluid secretion. Am J Physiol 272:C1672 -C1679, 1997[Abstract/Free Full Text]
8. Burt DR, Ganesan KL: GABA_A: Receptor subtypes. From pharmacology to molecular biology. FASEB J5 : 2916-2923,1991[Abstract]
9. Fritschy JM, Mohler H: GABA_A -receptor heterogeneity in the adult rat brain: Differential regional and cellular distribution of seven major subunits. J Comp Neurol359 : 154-194,1995[Medline]
10. Tyndale RF, Hales TG, Olsen RW, Tobin AJ: Distinctive patterns of GABA_A receptor subunit mRNAs in 13 cell lines. J Neurosci 14:5417 -5428, 1994[Abstract]
11. Amenta F, Cavallotti C, Iacopino L, Erdo SL: Autoradiographic localization of the GABA_A receptor agonist [³H]-muscimol within rat kidney. Pharmacology36 : 390-395,1988[Medline]
12. Molony DT, Pressley T, DuBose T, Mehta P: Murine renal medulla expresses an -aminobutyric acid (GABA)_{A 1} Cl^- channel that differs in cDNA sequences from the central nervous system (CNS) channel [Abstract]. J Am Soc Nephrol4 : 8751993
13. Sarang SS, Miller GW, Grant DF, Schnellmann RG: Expression and localization of the glycine receptor ß-subunit in human, rabbit and rat kidneys. Nephron 82:254 -260 1999[Medline]
14. Miller GW, Schnellmann RG: A putative cytoprotective receptor in the kidney: Relation to the neuronal strychnine-sensitive glycine receptor. Life Sci 55:27 -34, 1994[Medline]
15. McDonald BJ, Amato A, Connolly CN, Benke D, Moss SJ, Smart TJ: Adjacent phosphorylation sites on GABA_A receptor ß-subunits determine regulation by cAMP-dependent protein kinase. Nat Neurosci 1:23 -28, 1998[Medline]
16. Sieghart W: Structure and pharmacology of gamma-aminobutyric acid_A receptor subtypes. Pharmacol Rev47 : 181-234,1995[Medline]
17. Zalups RK, Barfuss DW: In vitro perfusion of isolated nephron segments: A method for renal toxicology. In: Methods in Renal Toxicology, edited by Zalups RK, Lash LH, Boca Raton, CRC,1997 , pp 123-146
18. Zeldin DC, DuBois RN, Falck JR, Capdevila JH: Molecular cloning, expression and characterization of an endogenous human cytochrome P450 arachidonic acid epoxygenase isoform. Arch Biochem Biophys 322:76 -86, 1995[Medline]
19. Ewert M, de Blas AL, Mohler H, Seeburg PH: A prominent epitope on GABA_A receptors is recognized by two different monoclonal antibodies. Brain Res 569:57 -62, 1992[Medline]
20. Ymer S, Schofield PR, Draguhn A, Werner P, Kohler M, Seeburg PH: GABA_A: receptor ß subunit heterogeneity: Functional expression of cloned cDNAs. EMBO J 8:1665 -1670, 1989[Medline]
21. Fernando LP, Khan ZU, de Blas AL: Antibodies to the rat ß3 subunit of the gamma-aminobutyric acid_A receptors. Brain Res Mol Brain Res 28:94 -100, 1995[Medline]
22. McKernan RM, Whiting PJ: Which GABA_A-receptor subtypes really occur in the brain? Trends Neurosci19 : 139-143,1996[Medline]

This article has been cited by other articles:

				K. Mizuta, D. Xu, Y. Pan, G. Comas, J. R. Sonett, Y. Zhang, R. A. Panettieri Jr., J. Yang, and C. W. Emala Sr. GABAA receptors are expressed and facilitate relaxation in airway smooth muscle Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1206 - L1216. [Abstract] [Full Text] [PDF]

				S. S. Sarang, S. M. Lukyanova, D. D. Brown, B. S. Cummings, S. R. Gullans, and R. G. Schnellmann Identification, Coassembly, and Activity of {gamma}-Aminobutyric Acid Receptor Subunits in Renal Proximal Tubular Cells J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 376 - 382. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by SARANG, S. S. Articles by SCHNELLMANN, R. G. Search for Related Content PubMed PubMed Citation Articles by SARANG, S. S. Articles by SCHNELLMANN, R. G.