 |
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
|
||||
| 2007 JASN IMPACT FACTOR 7.111 | HOME AUTHOR INFO EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP | |||
| CURRENT ISSUE | ARCHIVES | JASN Express | ONLINE SUBMISSION | |
*
Institute of Biochemistry (CSIC-UCM), Faculty of Pharmacy, Complutense
University, Madrid, Spain.
Experimental Medicine and Surgery Unit, Gregorio
Marañón
University General Hospital, Madrid, Spain.
Correspondence to Dr. Lisardo Boscá, Instituto de Bioquímica, Facultad de Farmacia, 28040 Madrid, Spain. Phone: + 34-91-394-1853; Fax: + 34-91-394-1782; E-mail: boscal{at}eucmax.sim.ucm.es
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The pathways that lead to apoptosis in response to NO involve the release
of mitochondrial mediators as deduced by the prevention of apoptosis using
caspase inhibitors acting downstream in the mitochondrial signaling pathway
(17,18).
Constitutive expression of endothelial NO synthase (NOS-3) has been identified
in epithelial cells of the kidney, including those of the proximal tubule,
thick ascending limb, and inner medullar collecting duct and in interstitial
cells (19). Moreover,
bacterial cell wall products, such as lipopolysaccharide (LPS) and
lipopeptides (TPP), and proinflammatory cytokines, such as interleukin-1
(IL-1ß), interferon-
(IFN-), and tumor necrosis
factor-
(TNF-), are important mediators in the progression of
acute renal failure, which is a frequent complication of sepsis, and exert the
cytotoxic effects through the expression of the high-output NO synthase NOS-2
(20). NO and its derived
metabolite peroxynitrite (ONOO-) participate in renal tubular cell
injury, in the regulation of renal hemodynamics and sodium tubular transport,
and in the cytotoxic mechanisms responsible for acute renal allograft
rejection, where macrophages express high levels of NOS-2
(9). We recently observed that
the apoptosis caused by NO in peritoneal macrophages was inhibited by
treatment of the cells with CsA or with FK506, mainly through the inhibition
of the expression of NOS-2
(21). In view of these
results, we investigated whether immunosuppressors and NO act on apoptotic
signaling in PTEC, because these cells have been described as extremely
sensitive to NO and CsA to induce apoptotic death. Our data show that contrary
to other cells, immunosuppressors and NO exert a synergistic action that
induces apoptosis on PTEC, probably through an increase of the release of
mitochondrial apoptotic mediators as reflected by the enhancement in the
activity of caspases 3 and 7.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
were
from Roche. Materials and chemicals for electrophoresis were from Bio-Rad
(Richmond, CA). Fluorescence probes were from Molecular Probes (Eugene, OR).
Antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Culture media
were from BioWhittaker (Verviers, Belgium).
Preparation of Pig Proximal Tubule Cells
Kidneys from healthy isogeneic mini-pigs (Maryland strain) were removed by
surgery under sterile conditions. Animals were cared for as outlined in the
"Guide for the Care and Use of Laboratory Animals" (NIH
publication). The kidney cortex (without medullar content) was sliced (2 mm
slices) and incubated for 30 min at 37°C with collagenase (0.6 mg/ml) in
Ham's-F12:Dulbecco's modified Eagle's medium (vol:vol) (incubation medium).
The digested tissue was centrifuged at 100 x g for 30 s, and
the pellet was washed twice with incubation medium. The cell pellet was
resuspended in 45% Percoll (10 ml of Percoll per gram of original tissue) and
centrifuged at 20,000 x g for 30 min. Proximal tubular cells
banded in a well-defined bottom layer that was characterized both
biochemically and morphologically following previous work
(22). Cells (1 to 2 x
106) were seeded in 6-cm dishes with incubation medium supplemented
with 2.5 mM glutamine, antibiotics, 10-8 M hydrocortisone, and 2%
of complement-free fetal calf serum. Cells were maintained for 2 d with a
daily change of medium and used after the third day in culture.
Measurement of Apoptosis
Apoptosis was determined by three independent criteria: the appearance of
DNA fragmentation, the release of oligonucleosomes from the nucleus to the
cytosol, and differential staining of the cells with propidium iodide (PI) and
SYTO 13 followed by microscopic observation of the nuclei. Internucleosomal
DNA fragmentation was analyzed by agarose gel as follows: The cell layer (1 to
2 x 106 cells) was washed twice with phosphate-buffered
saline, and the plasma membrane was lysed with 0.8 ml of 10 mM
ethylenediaminetetraacetate (EDTA), 0.25% Triton X-100, 20 mM Tris-HCl (pH
8.0; 15 min at 4°C). The DNA from the total cell extract was precipitated
with 70% ethanol plus 2 mM MgSO4 and treated for 4 h at 55°C
with 0.5 mg/ml proteinase K. After two extractions with phenol/chloroform, the
DNA was analyzed in a 2% agarose gel and stained with 0.5 µg/ml ethidium
bromide
(23,24).
Alternatively, the lysed cells were centrifuged at 30,000 x g
for 15 min to remove nuclei and mitochondria and the DNA present in the
soluble fraction was analyzed using an enzyme-linked immunosorbent assay cell
death kit (Boehringer) in which the histone-associated DNA fragments were
detected by a sandwich-enzyme immunoassay with antihistone and
anti-DNA-peroxidase antibodies. The relative degree of apoptosis was
quantitatively determined by measuring the peroxidase activity at 405 nm and
calculating the ratio between the enzyme activity of treated cells and the
corresponding value of control cells (enrichment factor). In addition to these
methods, the cells were stained in vivo with 0.005% of PI (red
fluorescence) and 50 µM SYTO 13 (green fluorescence; Molecular Probes). The
changes in cellular morphology and the appearance of apoptotic bodies were
determined by confocal microscopy.
Preparation of Nuclear Extracts
Protein extracts were prepared following the method of Schreiber et
al. (25), as described
previously. Protein content was assayed using the Bio-Rad detergent-compatible
protein reagent. All steps of cell fractionation were carried out at
4°C.
Electrophoretic Mobility Shift Assays
The oligonucleotide sequences that correspond to the consensus nuclear
factor 
B (NF-B) binding site (nucleotides -978 to -952)
5'TGCTAGGGGGATTTTCCCTCTCTCTGT3'
(26) of the murine NOS-2
promoter were used. Aliquots of 100 ng of annealed oligonucleotide were
end-labeled with Klenow enzyme fragment. A total of 5 x 104
dpm of the DNA probe were used for each binding assay of nuclear extracts as
follows: 3 µg of protein were incubated for 15 min at 4°C with the DNA
and 2 µg of poly(dI:dC), 5% glycerol, 1 mM EDTA, 100 mM KCl, 5 mM
MgCl2, 1 mM dithiothreitol, and 10 mM Tris-HCl (pH 7.8) in a final
volume of 15 µl. The DNA-protein complexes were separated on native 6%
polyacrylamide gels in 0.5% Tris-borate-EDTA buffer
(27). Supershift assays were
carried out after incubation of the nuclear extract with the antibody (0.5
µg) for 1 h at 4°C, followed by electrophoretic mobility shift assays
(EMSA). Anti-p50 (human), anti-c-Rel (human), and anti-p65 (murine) antibodies
were from Santa Cruz Biotechnology.
Analysis of Mitochondrial Transmembrane Potential by Confocal
Microscopy
To measure the mitochondrial transmembrane potential
(
m), cells were incubated at 37°C for 15 min in
the presence of 30 nM chloromethyl X-rosamine (CMXRos)
(18), followed by immediate
analysis of fluorochrome incorporation in a confocal microscope. As an
internal control, labeled cells were incubated with 10 µM of the uncoupling
agent m-chlorophenylhydrazone carbonylcyanide (m-ClCCP) that
decreased CMXRos fluorescence
(28,29).
Cells were visualized using an MRC-1024 confocal microscope (Bio-Rad), and the
fluorescence was acquired and electronically evaluated. Laser sharp software
(Bio-Rad) was used to determine the intensity of the fluorescence per pixel.
m was calculated as percentage of the change in cell
fluorescence versus the corresponding m-ClCCP condition
(100%).
Analysis of Mitochondrial Swelling
Mitochondria were prepared from renal cortex by differential centrifugation
in isolation medium (300 mM mannitol, 1 mM
ethyleneglycol-bis[ß-aminoethyl ether]-N,N[prime]-tetraacetic
acid, 10 mM Tris-HCl [pH 7.4]; 1 mM PO4H2K, 0.5 mM
phenylmethylsulfonyl fluoride, 0.2% bovine serum albumin and gassed with
N2) and resuspended 1:1 (vol:vol) in this medium. Mitochondrial
swelling was determined spectrophotometrically as described
(28). The mitochondrial volume
(µl/mg of protein) was calculated as [(1/A520 nm - 0.119)
x (protein)]/0.006. The assay was performed at 37°C under continuous
stirring.
Caspase Assay
The activity of caspases was determined in cell lysates using
N-acetyl-YVAD-7-amino-4-methylcoumarin (caspase 1) and
N-acetyl-DEVD-7-amino-4-methylcoumarin (caspases 3 and 7), respectively, as
fluorogenic substrates and following the instructions of the supplier
(PharMingen, San Diego, CA). The corresponding peptide aldehyde and
z-Val-Ala-DL-Asp-fluoromethylketone (z-VAD-.fmk) were used to inhibit the
caspase activity in vitro and in vivo, respectively, and to
ensure the specificity of the reaction. The linearity of the caspase assay was
determined over a 30-min reaction period.
Nitrite and Nitrate Determination
NO release to the culture medium was determined spectrophotometrically by
the accumulation of nitrite and nitrate as described
(21). Nitrate was reduced to
nitrite and determined with Griess reagent by adding sulfanilic acid and
naphthylenediamine (1 mM in the assay). The absorbance at 548 nm was compared
with a standard of NaNO2.
Western Blot Analysis
The cell layers were washed twice with ice-cold phosphate-buffered saline
and scraped off the dishes, and the cells collected by centrifugation.
Cytosolic extracts were prepared after homogenization with ice-cold 0.3 M
sucrose, 1 mM EDTA, 0.5 mM phenylmethyl-sulfonyl fluoride, 10 µg/ml
leupeptin, and 20 mM Tris-HCl (pH 8.0) and centrifugation for 10 min in an
Eppendorf centrifuge. Aliquots of 10 µg of the soluble protein were
submitted to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10%
gel) and transferred to a polyvinylidene difluoride membrane (Amersham, Buks,
UK). The amount of NOS-2 was measured using a rabbit anti-mouse NOS-2 antibody
(Santa Cruz Biotechnology) that recognized a protein of the expected size (130
kD). The blot was revealed using the enhanced chemiluminescence technique
(Amersham).
Statistical Analyses
The data shown are the mean ± SEM of four experiments. Statistical
significance was determined with t test for unpaired observations.
P < 0.05 was considered significant. In studies of Western blot
analysis, linear correlations between increasing amounts of input protein and
signal intensity were observed (correlation coefficients >0.8).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-1ß, and IFN-
(not shown) were ineffective, probably because these cytokines, especially
IFN-, were not species specific (see the "Discussion"
section; Figure 1C). However,
TPP induced important levels of NOS-2 and synergized with IL-1ß
(threefold increase in protein levels and enzyme activity at 24 h;
Figure 1, B and C). Because
NOS-2 expression requires the activation of NF-B, the sequence
corresponding to the B site of the murine NOS-2 promoter was used in
EMSA to evaluate the engagement of this transcription factor in stimulated
PTEC. As Figure 1D shows,
NF-B was activated upon treatment of the cells with LPS, TPP,
IL-1ß, and a high dose of murine TNF-. On analysis by supershift
assays, the bands retained corresponded mainly to p50-p65 (upper band) and to
p50-p50 dimers (lower band), respectively. It is interesting that LPS
increased the intensity of the upper band (p50-p65 complexes) to levels
similar to those elicited by TPP and IL-1ß, although the expression of
NOS-2 was lower when compared with the other bacterial stimuli TPP, suggesting
the requirement of another cytokine, probably IFN-, to accomplish NOS-2
expression as described for other cells
(26).
|
The NO synthesis induced by LPS and TPP decreased significantly after treatment of the cells with 10 nM CsA and FK506 (Figure 2). To ensure that this NO synthesis was due to the expression of NOS-2, cells stimulated with LPS or TPP were incubated with the NOS-2—specific inhibitor N-[3-(aminomethyl)benzyl] acetamidine (1400W) and the amount of nitrite plus nitrate was similar to that of untreated controls. Neither of the immunosuppressors influenced NO production in control cells. Concentrations of CsA higher than 100 nM were toxic for these cells as deduced by the release of lactate dehydrogenase to the extracellular medium after 24 h of culture (not shown).
|
NO, CsA, and FK506 Induce Apoptosis in PTEC
NO has been recognized as a self-sufficient molecule inducing apoptosis in
various cell types
(17,18,28).
Indeed, treatment of PTEC with NO donors such as 3-morpholinosydnonimine,
S-nitrosoglutathione (GSNO), and
1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate] (NOC18)
induced apoptosis as determined by the appearance of a characteristic DNA
ladder (Figure 3A) and by the
release of DNA oligonucleosomal moieties from the nucleus to the cytosol
(Figure 3B). CsA and FK506 also
promoted apoptotic death of PTEC, an effect that was potentiated in the
presence of stimuli that induce NOS-2 expression (TPP) or after release of
elevated concentrations of NO by NO donors
(Figure 3B). The dose-dependent
effect of CsA and FK506 on apoptosis is shown in
Figure 3C. The half-maximal
response was obtained at 20 nM and 15 nM of FK506 and CsA, respectively. This
ability of CsA and FK506 to induce apoptosis in PTEC was evaluated also by
confocal microscopy using PI and SYTO 13 simultaneous staining. As
Figure 4 shows, CsA and FK506
induced the appearance of apoptotic bodies and chromatin condensation in PTEC,
a process that was enhanced in the presence of the NO donor GSNO. A
quantitative determination of the cell population exhibiting apoptotic
features is shown in Table 1.
Agreement was observed between the percentage of cells with apoptotic bodies
(Table 1) and the relative
accumulation of oligonucleosomes in the cytosol
(Figure 3, B and C). Moreover,
incubation of cells with the general caspase inhibitor z-VAD.fmk and with
DEVD-CHO, that inhibits preferentially the downstream caspases 3 and 7,
prevented the apoptosis induced by NO donors and immunosuppressors. The
inhibition of apoptosis exerted by z-VAD.fmk persisted significantly up to 72
h after treatment with GSNO and CsA (Table
1). Also, other inhibitors of apoptosis, such as 3-aminobenzamide
and 6(5H)phenanthridinone
(30,31),
were very efficient in protecting the cells from apoptosis (see the
"Discussion" section). These data suggest that the apoptosis
induced in PTEC by NO donors and immunosuppressors can be inhibited
pharmacologically with these drugs.
|
|
|
A decrease of m has been described as a common, if
not causal, event in the induction of apoptosis in several cell types
(28,29).
Incubation of PTEC with CMXRos as probe for the determination of the
m showed a decrease of potential after prolonged
treatment with GSNO and CsA (6 h). Simultaneous addition of GSNO and CsA did
not enhance the decrease of m, suggesting the use of
a common pathway in the irreversible opening of the permeability transition
pore (PT; Figure 5A). As a
positive control, we determined the changes of the fluorescence produced by
the uncoupling drug m-ClCCP, which was considered as 100% of the
decrease of m. These results are compatible with a
role for the fall of m in CsA-dependent apoptosis.
However, CsA has been characterized as an inhibitor of the PT in various cell
types, at least at short periods. Indeed, this was the case, and the pore
remained unchanged during the early 20 min after CsA treatment
(Figure 5A), a period during
which no changes in volume of isolated mitochondria incubated with succinate
were observed (Figure 5B). In
agreement with these data, mitochondrial swelling was observed after 25 to 30
min of incubation with succinate and CsA.
|
Activation of Caspases in PTEC
The preceding results suggest a contribution of mitochondrial signals to
induction of apoptosis in PTEC cells treated with NO donors and
immunosuppressors. To determine the involvement of caspases in this process,
we measured the activity of DEVD-specific caspase (3 and 7), which mediates
the executioner step of apoptosis, and caspase 1 (YVAD as substrate), which is
more related to inflammatory mechanisms. As
Figure 6 shows, DEVDase
activity increased in cells that were treated with GSNO and to a lower extent
in cells that were stimulated with CsA and FK506. Incubation of cells with
GSNO and CsA or FK506 did not increase significantly the caspase activity
induced by GSNO, suggesting the convergence in the mechanisms of caspase
activation. The activity of caspase 1 remained unchanged regardless of the
treatments used, indicating that this activity was not involved in the
process.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
One advantage of the experimental model used was that the cell cultures
were virtually depleted of monocytes and activated T cells; therefore, the
immunomodulatory molecules that were produced after cell stimulation were
synthesized mainly by PTEC. This was confirmed by the absence in unstimulated
cells of NF-B activity, a good sensor of inflammatory stress
(36,37).
The mechanisms by which CsA and FK506 promote apoptosis in PTEC are not
clearly established, but mitochondrial swelling as a result of the fall of
mitochondrial PT after treatment with these drugs has been observed
consistently. Mitochondrial PT opening has been identified as a target of the
apoptotic action of NO both in intact cells and in reconstituted systems that
contain isolated mitochondria and nuclei
(18,28,29).
Indeed, caspase 3 activity increased in cells that were treated with GSNO,
CsA, or FK506; however, absence of synergic effects was observed when PTEC
cells were incubated with GSNO and CsA or FK506, suggesting the use of a
common downstream apoptotic pathway. Moreover, peptide inhibitors of caspases
such as zVAD-fmk and DEVD-CHO (which inhibit caspase 3 and related caspases)
prevented NO and CsA/FK506-induced apoptosis in PTEC cells.
Several pathways have been proposed to explain the sensitivity of PTEC to undergo apoptosis (6). These included enhancement of oxygen radical synthesis in the ischemia-reperfusion injury (38,39). Under these conditions, poly-ADP-ribose polymerase (PARP) inhibitors proved to be effective in protecting against apoptosis (40). In agreement with these results, incubation of PTEC with PARP inhibitors 3-AB and possibly 6(5H)phenanthridinone abrogated the apoptosis induced by immunosuppressors and NO donors. The other candidate to mediate the toxic effects of NO and reactive oxygen species is peroxynitrite. Indeed, in models of LPS-induced kidney injury, an accumulation of nitrotyrosine has been detected in PTEC, and it has been proposed that protein nitration may participate in renal failure. The precise mechanism of action of peroxynitrite in these cells is not fully understood (38,41); however, it seems to involve an inhibition of the adhesion properties of the PTEC, a process lost as a result of NO and OONO synthesis (42). In this regard, removal of NO and peroxynitrite with scavengers protected efficiently against ischemia/reperfusion injury in the course of acute renal failure (12,13).
Other indirect data suggest an important role for NO in the degeneration of kidney functions, e.g., supplementation of the diet with arginine increases renal injury (15). Moreover, in transgenic sickle cell mouse kidney, there is an overproduction of NO as a result of the massive expression of different forms of NOS promoting apoptosis of PTEC and renal failure (38). An enhanced NO synthesis together with the elevated accumulation of oxygen superoxide leads to formation of peroxynitrite and induction of apoptotic death of PTEC via tyrosine nitration of proteins (38). These data point to mitochondrial apoptotic signaling as one of the key factors that mediate the sensitivity of renal cells to undergo apoptosis. In agreement with this suggestion, mice that lack Bcl-2 develop polycystic kidneys and exhibit rapid renal failure (4). In addition to the mitochondrial mediators, the coexistence of Fas signaling induced by CsA and possibly by FK506 might explain the cooperative induction of apoptosis by these two pathways (43).
The data reported show a selective capacity of PTEC to express NOS-2. PTEC
exhibit a slight response to LPS in terms of NOS-2 expression, despite the
intense activation of NF-B observed by EMSA. However, challenge with
proinflammatory stimuli, such as IL-1ß, allows the synthesis of large
amounts of NO that are near the range of those elicited by activated
macrophages (under similar experimental conditions, the steady-state levels of
NO synthesis by activated RAW cells and PTEC stimulated with lipid A plus
IL-1ß were 2 and 1.2 nmol of NO per hour and milligram of cell protein,
respectively). In addition to this source of NO, the possible contribution of
the infiltration of inflammatory cells such as macrophages cannot be
disregarded. These data should be considered in other pathologies, such as
multiorgan failure, in which treatment with inhaled NO has been proposed
(44).
In summary, our results show that PTEC exhibit a marked sensitivity to apoptosis that involves the activation of DEVD-specific caspases, a process that is initiated independently by immunosuppressors and proinflammatory stimuli and that constitutes a main cause of renal injury. Evaluation of strategies that contribute to inhibition of NOS-2 expression (40), to support mitochondrial function, e.g., the use of radical scavengers, or to inhibit downstream apoptotic events, e.g., PARP inhibitors, might help to improve renal function under compromised situations, such as the immunosuppression that accompanies organ transplantation.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and lipopolysaccharide induce apoptotic cell death in bovine
glomerular endothelial cells. Kidney Int55
: 2322-2337,1999[Medline]
and bacterial lipopolysaccharide. J Exp Med177
: 1779-1784,1993Bß and abrogation of NF-B activity in
peritoneal macrophages stimulated with lipopolysaccharide. J Biol
Chem 272:23025
-23030, 1997-treated L929 fibroblasts. Scand J
Immunol 49:126
-130, 1999[Medline]
B
activation reduces cortical tubulointerstitial injury in proteinuric rats.
Kidney Int 56:118
-134, 1999[Medline]
B.
Curr Opin Cell Biol 11:226
-232, 1998
This article has been cited by other articles:
 |
|
 |
|
  A. B. Sanz, B. Santamaria, M. Ruiz-Ortega, J. Egido, and A. Ortiz Mechanisms of Renal Apoptosis in Health and Disease J. Am. Soc. Nephrol., September 1, 2008; 19(9): 1634 - 1642. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Periyasamy, M. Warrier, M. P. M. Tillekeratne, W. Shou, and E. R. Sanchez The Immunophilin Ligands Cyclosporin A and FK506 Suppress Prostate Cancer Cell Growth by Androgen Receptor-Dependent and -Independent Mechanisms Endocrinology, October 1, 2007; 148(10): 4716 - 4726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Neria, C. Caramelo, H. Peinado, F. R. Gonzalez-Pacheco, J. JP. Deudero, A. J. de Solis, R. Fernandez-Sanchez, S. Penate, A. Cano, and M{a} A. Castilla Mechanisms of endothelial cell protection by blockade of the JAK2 pathway Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1123 - C1131. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Dai, M. F. Hebert, N. Isoherranen, C. L. Davis, C. Marsh, D. D. Shen, and K. E. Thummel EFFECT OF CYP3A5 POLYMORPHISM ON TACROLIMUS METABOLIC CLEARANCE IN VITRO Drug Metab. Dispos., May 1, 2006; 34(5): 836 - 847. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. M. Tiwari, R. W. Brock, J. K. Megyesi, G. P. Kaushal, and P. R. Mayeux Disruption of renal peritubular blood flow in lipopolysaccharide-induced renal failure: role of nitric oxide and caspases Am J Physiol Renal Physiol, December 1, 2005; 289(6): F1324 - F1332. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Perez, M. Castilla, A. M. Torres, J. A. Lazaro, E. Sarmiento, and A. Tejedor Inhibition of brush border dipeptidase with cilastatin reduces toxic accumulation of cyclosporin A in kidney proximal tubule epithelial cells Nephrol. Dial. Transplant., October 1, 2004; 19(10): 2445 - 2455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Notenboom, D. S. Miller, P. Smits, F. G. M. Russel, and R. Masereeuw Involvement of guanylyl cyclase and cGMP in the regulation of Mrp2-mediated transport in the proximal tubule Am J Physiol Renal Physiol, July 1, 2004; 287(1): F33 - F38. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Justo, C. Lorz, A. Sanz, J. Egido, and A. Ortiz Intracellular Mechanisms of Cyclosporin A-Induced Tubular Cell Apoptosis J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3072 - 3080. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. D. Smith, L. E. Wrenshall, R. F. Nicosia, R. Pichler, C. L. Marsh, C. E. Alpers, N. Polissar, and C. L. Davis Delayed Graft Function and Cast Nephropathy Associated with Tacrolimus Plus Rapamycin Use J. Am. Soc. Nephrol., April 1, 2003; 14(4): 1037 - 1045. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. V. Alvarez-Arroyo, S. Yague, R. M. Wenger, D. S. Pereira, S. Jimenez, F. R. Gonzalez-Pacheco, M. A. Castilla, J. J. P. Deudero, and C. Caramelo Cyclophilin-Mediated Pathways in the Effect of Cyclosporin A on Endothelial Cells: Role of Vascular Endothelial Growth Factor Circ. Res., August 9, 2002; 91(3): 202 - 209. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. C. Bakker, C. van Kooten, M. E. van de Lagemaat-Paape, M. R. Daha, and L. C. Paul Renal tubular epithelial cell death and cyclosporin A Nephrol. Dial. Transplant., July 1, 2002; 17(7): 1181 - 1188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Peherstorfer, B. Mayer, S. Boehm, A. Lukas, P. Hauser, G. Mayer, and R. Oberbauer Effects of microinjection of synthetic Bcl-2 domain peptides on apoptosis of renal tubular epithelial cells Am J Physiol Renal Physiol, July 1, 2002; 283(1): F190 - F196. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Notenboom, D. S. Miller, P. Smits, F. G. M. Russel, and R. Masereeuw Role of NO in endothelin-regulated drug transport in the renal proximal tubule Am J Physiol Renal Physiol, March 1, 2002; 282(3): F458 - F464. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
HOME
CURRENT ISSUE
ARCHIVES
JASN Express
ONLINE SUBMISSION
AUTHOR INFO
EDITORIAL BOARD SUBSCRIBE FEEDBACK ALERTS HELP |
